Part:BBa_K5107007

T7-HREmin-sB-T

7-HREminimal-sB-T is a construct used in the cell free biosensor. The HREminimal is recognised by the steroid androgen, progesterone and glucocorticoid hormone receptors. Through this interaction, the in vitro transcription of a monomeric broccoli aptamer is controlled based on the presence of EDCs.

Usage and Biology

For the structure of the biosensor, we took inspiration from the ROSALIND cell-free biosensor[1], modifying their design to match our goals. We kept the general idea of having a Transcription Factor (TF) altering the activity of a RNA polymerase, and the output signal as a consequence. We tailored the ROSALIND concept by selecting specific custom transcription factors (TFs) as receptors and designing unique operator sequences to serve as responsive elements.

Cell free biosensor

This is the principal function of our designed biosensor

Figure 1:Cell-Free System - No Hormone/EDC in the environment.

Figure 2: Cell-Free System - Hormone/EDC in the environment.

When no EDC is present(Figure 1), the receptor will not bind the DNA, and thus the T7 RNA polymerase is free to interact with the promoter, and transcribe the Broccoli aptamer. Once produced, the aptamer binds to the DFHBI-1T fluorophore, and enables fluorescence, by absorbing light at 472 nm and emitting it at 507 nm. When an EDC is present(Figure 2), it will bind the hormone receptor and induce a conformational change that will allow it to bind the receptor response element. Once the receptor is bound to the DNA, it will act as a repressor, suppressing the transcription from the T7 RNA promoter.

Assemply

Human Receptor Information

Human Receptor	Response Element (Operator Site)	Natural Hormone	Plasmid Name (In-Cell System)
Estrogen Receptor α (ERα)	ERE	17β-Estradiol	pRR-ERalpha-5Z
Estrogen Receptor β (ERβ)	ERE	17β-Estradiol	pRR-ERbeta-5Z
Glucocorticoid Receptor (GR)	HRE	Dexamethasone	pRR-GR-5Z
Androgen Receptor (AR)	HRE	Testosterone	pRR-AR-5Z
Mineralocorticoid Receptor (MR)	HRE	Aldosterone	pRR-MR-5Z
Progesterone Receptor (PR)	HRE	Progesterone	pRR-PR-5Z

Table 1: Overview of receptors along with corresponding response elements and natural hormones. Finally the plasmid used for the in-cell assay is noted.

We designed DNA templates using two response elements: ERE and HRE, designed to interact with the above-listed receptors (see Table 1 for details). We designed versions with only a single response element and only a single repeat. For its minimalistic approach, we denoted these parts HREminimal:BBa_K5107000 and EREminimal:BBa_K5107001. The sequence for these parts can be seen below:

Minimal Response Elements

Element	Sequence
HREminimal	CCAGGTCAGAGTGACCTG
EREminimal	AGAACAGAGTGTTCT

Table 2: Minimal Response Elements

• Design - Generating a measurable readout

As for the output, we decided to go for a less tedious reporter than the one previously used. For our cell-free system, the simplest and fastest way to have an output is to use an aptamer, and we opted for the fluorescent broccoli aptamer, which, when bound to the fluorophore DFHBI-1T, will produce green fluorescence upon excitation. We design the single broccoli aptamer (abbreviated “sB”) surrounded by two tRNA scaffolds to increase its stability (inspired by iGEM20_Edinburgh) in combination with the HREminimal and EREminimal responsive elements. The reason for this choice is that we discovered a synthesis limitation during a preliminary check on our sponsor IDT's website.

The ready-to-be-synthesized DNA templates named T7-HREminimal-sB-T and T7-EREminimal-sB-T are shown in the image below:

Figure 3:Overview of the T7-HREminimal-sB-T and T7-EREminimal-sB-T DNA fragments used for the cell-free system. T7 promoter, response elements, aptamer parts and terminators are shown. Not to scale.

Primers for IVT Template

	Forward Primer	Reverse Primer
IVT Template	gcggataacaatttcacacaggaaacagc	caaaaaacccctcaagacccg

Table 3: Primer for IVT template amplification

• Validation

As we mentioned above, the construct is ready-to-be-synthesized, that means it is delivered to us by IDT as a G-block. Then using appropriate primers(Table 2) we amplify and purify the IVT template used in our biosensor. Here it is shown only the gel electrophoresis of the T7-HREminimal-sB-T.

Figure 4:PCR validation of the cell free biosensor template(T7-HREminimal-sB-T) in 1% gel agarose-SYBR Safe DNA Gel Stain.

Test and Optimization

To test the created parts, we performed two iterations. Firstly, we tested and optimized the fluorescence output without the presence of any receptor or ligand (Test & Learn I), to ensure that the design at its basic level works properly. Secondly, we proceeded by testing the biosensor on its whole with the receptor and the ligands (Test & Learn II).

1. Wavelength and Plate reader setting

• Rationale: As the signal for the first experiments was erratic and sometimes incoherent, we tried to improve the reading settings.

• Result:Higher fluorescence output was yielded by:

Using the wavelength couple 488/530 nm. 
Reading from the top (instead from the bottom)

Figure 5: Wavelength optimization.Fluorescein sodium salt was used as reference.

2. Buffer test

• Rationale: Optimize the reaction to increase the signal

Initially, for the first transcription test, we used a custom In Vitro Transcription (IVT) buffer recommended from the ROSALIND protocol (where we took the inspiration for the cell-free system). However, we didn’t get any fluorescence emission by using that custom buffer.

• Result: The commercial In Vitro Transcription (IVT) buffer was better than the custom made.

When using the commercial buffer, we could see a much higher output signal. The custom buffer clearly is not ideal for the cell-free transcription, while the commercial buffer seems to work much better. A possible explanation for this is the ionic concentration, which is much higher in the custom buffer (especially NaCl). Either the indicated concentrations were wrong (we in fact acknowledge a mistake in the ROSALIND protocol, as the indicated concentration of the NaCl ion was too high) or we made a mistake in the process of preparing it.

3. DNA concentration

• Rationale: Increase the sensitivity of the biosensor, enlarge the limits of detection, and reduce the cost of testing.

Reducing the amount of DNA enhances both sensitivity and the limit of detection, which are critical factors for our stakeholders. This reduction will ultimately lower the detection threshold, allowing even trace amounts of EDCs in the tested water to produce measurable inhibition. Additionally, it enables us to minimize the use of the receptor, the most expensive component of the biosensor system.

• Results: A concentration of 10 nM of DNA was sufficient to yield a substantial signal and the best one to perform the next experiments, also according to the modeling analysis.

Figure 6: Test for different DNA concentrations in order to have a readable and measurable signal. Measurements were taken after 1 hour for 20 minutes. Error bars represent standard deviation of triplicates.

We didn’t test for lower DNA concentration, as, for the first iteration, it was not recommended by the initial modeling analysis with the data from literature (see Modeling).

4. Assessment of Inhibitors & Interferents in the assay

• Rationale: Scout and test the effects of inhibitors and interferents on the signal output.
• Results: Some compounds can negatively affect the aptamer production:

1. Testosterone Hormone
2. Sarkosyl (above 0.25%) [2]
3. Ethanol (above 2.5%) [3]

Figure 7:Effects of inhibitors and interference on the fluorescence output. The T7-HREminimal-sB-T DNA template was used where DNA is indicated. The intensity of the signal is expressed as Micromolar Equivalent Fluorescein (MEF), more specifically Fluorescein Sodium Salt (FSS). Error bars indicate standard deviation of triplicates of measurements taken after 1h incubation with the T7 polymerase.

We tested the hormone dissolved both in water and ethanol at 4µM concentration to assess the influence of each solvent. Additionally, we examined the effect of sarkosyl, a surfactant included in the buffer of the purchased receptor. To standardize and make comparable the values from different experiments, we included in each measurement a serial dilution of Fluorescein Sodium Salt (FSS), from the distribution kit, and normalized the values as Micromolar Equivalent Fluorescein (MEF) As the hormone itself has an influence on the fluorescence, we took that into account for the next tests. In particular, for testosterone dissolved in ethanol (used in future experiments), the signal was reduced to ~65% when compared to the transcription alone (from a modeling analysis, see Modeling). Moving on to sarkosyl, seeing the results prompted us to change the receptor buffer before using it for the reactions.

For the second iteration of testing, we focused solely on the Androgen Receptor, as limiting the scope simplified the process and additional receptors were unavailable due to failed production and canceled orders. Only the T7-HREminimal-sB-T and T7-HRE5-dB-T, compatible with the Androgen Receptor, were tested using Testosterone (the natural ligand of the receptor).

5.Optimal Receptor concentration & Validity of Assumptions - Mechanism of the Biosensor

• Rationale: Determine the optimal receptor concentration for the best detection and investigate the mechanism of the designed biosensor
• Results:

1. Receptor concentration:: The optimal concentration determined for the androgen receptor is in the range of 0.75~1 µM.To determine the optimal receptor concentration for the best detection, we measured and compared the fluorescence output at various receptor concentrations, analyzing the signal both in the presence and absence of the ligand.In particular, the difference between the presence and absence of the ligand is the most evident when the concentration of the receptor is 1 µM (see Figure 8), reason why we decided to further the analysis on this concentration.
2. Validity of Assumptions::Firstly, upon adding the receptor, we observed a significant decrease in the signal.It is clear that the receptor binds to the DNA and inhibits the signal even in the absence of the ligand.On the other hand, even in the presence of the ligand, the signal is lower compared to when the receptor is absent.Overall, our first hypothesis that the receptor is not able to recruit the T7 RNAP is confirmed, but the second hypothesis that the receptor cannot bind to the DNA absence of the ligand is rejected.
3. Mechanism of the Biosensor:In sight of these results, we reconsidered the working mechanism of the biosensor: it behaves as an OFF/ON type, insead of ON/OFF. In fact, the detection of ligands happens for the opposite of what we were expecting: an increase rather than a decrease in the signal. When the receptor alone is added, it binds to the DNA template, inhibiting the transcriptional activity of the T7 RNAP. On the other hand, when also the ligand is present, the affinity for the DNA seems to be lower, and, as a consequence, the activity of the T7 RNAP is partially restored, resulting in an increase of the signal. This suggests that the receptor unbinds from the DNA when the ligand is present.

Figure 8: Comparison of different receptor concentrations after 1h incubation with the T7 polymerase. R - Androgen receptor, H - Testosterone Hormone (4µM in all reactions where indicated). The T7-HREmin-sB-T DNA template (at a concentration of 10 nM) was used where DNA is indicated. The signal has been adjusted considering the negative effect of the hormone on the fluorescence. Error bars, when present, represent standard deviation of triplicates (duplicates only for receptor concentration 0.75 µM).

6. Proof of Concept & Predicted Limit of Detection (LOD)

• Rationale: Even though the working mechanism of the biosensor is opposite than designed, we can still see a difference between the presence and absence of the ligand, which we want to further investigate.
• Results: The biosensor is able detect with statistical significance the presence of the ligand.

Figure 9: Difference in signal between presence and absence of the testosterone hormone (indicated as H, at 4 µM) with the androgen receptor (R), and the DNA template (at a concentration of 10 nM). For each time point, a statistical t-test was performed between the two shown measurements. The p-value for each test is shown as stars symbols above the top point.

From this analysis, we show how the ENDOSENSE can, as a proof of concept, detect an EDC, in this case, the testosterone hormone, with a high statistical significance. This is indeed a great improvement from the current detecting methods, as the ENDOSENSE biosensor can reduce the testing time from days to hours.From the modeling analysis of this and the previous data, we were able to determine the Limits Of Detection (LOD) of biosensor: the upper LOD is 8.39 μM and the lower is 0.1 µM of testosterone concentration

7. Test with EDCs

• Rationale: After having demonstrated that the ENDOSENSE biosensor can detect the natural ligand of the receptor (testosterone), we wanted to test it with some proven EDCs, which we got thanks to our collaboration with iGEM24_UCopenhagen. In particular, we tested with PCB (polychlorinated biphenyls) and BAC (Benzanthracene).
• Results: Unfortunately, we noticed that when the receptor was added, there is no decrease in the signal, regardless of the hormone/edc presence.

Figure 10: Measured signal for two different DNA templates (DNA1: T7-HRE5-dB-T grouped on the left; and DNA2: T7-HREmin-sB-T grouped on the right), addition of androgen receptor (R) and testosterone (H). For the T7-HREmin-sB-T two different EDCs have been tested: PCB (polychlorinated biphenyls) and BAC (Benzanthracene).

From this observation, we concluded that the receptor in this experiment was denatured and not functional, likely due to the buffer exchange process and/or repeated freeze-thaw cycles. Thus, the results regarding the detection are not to be considered in this experiment. Despite this, the data clearly indicate a negative effect of the tested EDCs on the transcription process. With the receptor's functionality ruled out, it is evident that the EDCs directly influenced the fluorescence output. This finding suggests that, for future experiments, we should normalize the signal using samples with the EDCs, following the same approach applied with the hormone in earlier tests.

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal XbaI site found at 72
  Illegal PstI site found at 60
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal PstI site found at 60
  
• 21
  COMPATIBLE WITH RFC[21]
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal XbaI site found at 72
  Illegal PstI site found at 60
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal XbaI site found at 72
  Illegal PstI site found at 60
  Illegal AgeI site found at 112
  
• 1000
  COMPATIBLE WITH RFC[1000]

References

1. Chen, R., Cheng, H., Jin, P., Song, L., Yue, T., Hull, M., & Mansell, T. J. (2020). Nature Biotechnology, 38(10), 1107–1112. https://doi.org/10.1038/s41587-020-0571-7
2. Szentirmay, M. N., & Sawadogo, M. (1994, December 11). Sarkosyl block of transcription reinitiation by RNA polymerase II as visualized by the colliding polymerases reinitiation assay. Nucleic acids research. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC332080/
3. Haft, R. J. F., Keating, D. H., Schwaegler, T., Schwalbach, M. S., Vinokur, J., Tremaine, M., Peters, J. M., Kotlajich, M. V., Pohlmann, E. L., Ong, I. M., Grass, J. A., Kiley, P. J., & Landick, R. (2014). Correcting direct effects of ethanol on translation and transcription machinery confers ethanol tolerance in bacteria. Proceedings of the National Academy of Sciences, 111(25), E2576–E2585. https://doi.org/10.1073/pnas.1401853111