Part:BBa_K5317012
CMV-MTF1-mRuby2
Usage and Biology
The Metal Regulatory Transcription Factor 1 (MTF-1) is a metal ion-sensing transcription factor, regulating primarily zinc, cadmium and copper homeostasis and detoxification (Tavera-Montañez et al., 2019; Wimmer et al., 2005). Activation of the cytoplasmic MTF-1 due to increasing levels of heavy metals in the cytoplasm results in its translocation into the nucleus and binding via its zinc finger domains to MREs, specifically consensus TGCRCNC in promoter regions of the DNA. Thereby MTF-1 regulates expression of metallothioneins, metal transporters, and antioxidant genes as protection against metal toxicity and oxidative stress (Tavera-Montañez et al., 2019). Additional stimuli of MTF-1 nucleus import are stress signals such as heat shock, H2O2, low extracellular pH (Saydam et al., 2001).
The composite part fusing the MTF-1 with the reporter protein mRuby2 (K5317001) enables the visualization of the transcription factor localization in the cell in dependence of the free metal ion concentration. Its integration into a plasmid was needed for running the co-transfecting experiments together with the MRE-containing promoters upstream of EGFP to build the cell-based metal detection sensor.
Cloning
Theoretical Part Design
In order to generate the composite part, the basic part MTF-1 (K5317007) was integrated together with the reporter gene mRuby2 (K5317001) into the EGFP-C2 (K3338020) backbone after NheI- and BamHI-digestion. The Stop codon at the C-terminus of MTF-1 was deleted to ensure undisturbed translation of the C-terminal placed mRuby2.
Sequence and Features
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1785
Illegal PstI site found at 1030
Illegal PstI site found at 1362
Illegal PstI site found at 1819
Illegal PstI site found at 1886
Illegal PstI site found at 1924
Illegal PstI site found at 2341
Illegal PstI site found at 2671 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1785
Illegal PstI site found at 1030
Illegal PstI site found at 1362
Illegal PstI site found at 1819
Illegal PstI site found at 1886
Illegal PstI site found at 1924
Illegal PstI site found at 2341
Illegal PstI site found at 2671 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1785
Illegal BamHI site found at 1220 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1785
Illegal PstI site found at 1030
Illegal PstI site found at 1362
Illegal PstI site found at 1819
Illegal PstI site found at 1886
Illegal PstI site found at 1924
Illegal PstI site found at 2341
Illegal PstI site found at 2671 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1785
Illegal PstI site found at 1030
Illegal PstI site found at 1362
Illegal PstI site found at 1819
Illegal PstI site found at 1886
Illegal PstI site found at 1924
Illegal PstI site found at 2341
Illegal PstI site found at 2671
Illegal NgoMIV site found at 2599 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 2710
Cloning
The CMV promoter was provided by the EGFP-C2 backbone (K3338020) and remained throughout the NheI- and BamHI-digestion, while the EGFP was cut out. The correct assembly order, placing MTF-1 downstream of the CMV promoter and fusing mRuby2 to its C-terminus, was achieved by amplifying the inserts with the primers listed in table 1, creating about 20 bp overhangs.
| Primer name | Sequence |
|---|---|
| MTF1_fw | CAGAGCTGGTTTAGTGAACCGTCAGATCCGATGGGGGAACACAGTCCAGAC |
| MTF1_rev | gcccttagacaccatGGGTGGCAGCTGCAGG |
| mRuby2_fw | CTGCAGCTGCCACCCatggtgtctaagggcgaagagc |
| mRuby2_rev | ATCCCGGGCCCGCGGTACCGTCGACTGCAGcttgtacagctcgtccatccc |
Figure 1: The vector map depicts the assempled plasmid when MTF-1 is fused C-termianlly with the reporter gene mRuby2 and both fragments inserted downstream of the constitutive active CMV promoter.
Characterization
The CMV promoter ensures a strong and constitutive expression of the MTF-1 protein in HEK293T cells and the C-terminally fused mRuby2 fluorescent protein allows for the tracking of MTF-1 during varying conditions. We performed single- and co-transfection experiments of the CMV-MTF1-mRuby2-C2 with or without the varying MRExx-EGFP-C2 plasmids (K5317008 - K5317011).
Single-transfection experiments
As described in the Usage and Biology section, MTF-1 is capable of binding metal-ions direct or indirect, which leads to the translocation of MTF-1 from the cytoplasms into the nucleus. Therefore, we conducted experiments first analyzing the localization of MTF-1 by single-transfecting HEK293T cells with the CMV-MTF1-mRuby2-C2 plasmid with and without the presence of CuSo4 via microscopy.
Figure 2: Representative microscopy image of HEK293T cells expressing MTF1-mRuby2-C2. Shown are brightfield (left), fluorescence channel for mRuby2 (center) and an overlay of both channels (right).
The mRuby2 signal, mirrowing the MTF-1 localization, shows a nuclear distribution even under unstimulated conditions in HEK293T cells. This could possibly lead to a interaction with MRE sites in the genome even under homeostatic conditions, making experiments to assess the basal MRE site-containing promoter activity neccessary with and without metal ion stimulation. These results are presented in the following sections.
Co-transfection experiments
MTF-1 is the essetial signal converter and transmitter of the metal ion sensor, detecting the metal ions in the cytoplasm and transferring the presence into a transcriptional signal. Since the single-transfection expreiments of all the MRE sites-containing promoters (K5317008 - K5317011) indicated no basal promoter activity without MTF-1 co-transfection under unstimulated conditions, es expected, all continuous experiments were perfeormed by double-transfecting HEK293T cells with the MTF1-mRuby2-C2 together with one of the MRE site-containing promoter-EGFP-C2 plasmids.
Figure 3: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2-C2 and with the C2 plasmid carrying the promoter-reporter gene cassette MREwt-EGFP (a, K5317008), 4xMREa-EGFP (b, K5317009), 4xMREd-EGFP (c, K5317010) or MREdada-EGFP (d, K5317011). Shown are brightfield channels (left), fluorescence channels (images in the center) and an overlay of the channels (right; mRuby2 (red), EGFP (green)). Scale bar = 20 µm.
The double-transfection experiments for each MRE promoter construct together with the MTF1-mRuby2-C2 plasmid showed a nuclear localization of the MTF-1-mRuby2 in all experiments, while the EGFP-signal, already present under unstimulated conditions, was localized more in the cytoplasm. All promoters showed a high basal activity independent of metal ion administration. Possibly due to metal ion presence in the culture media, interacting with the MTF-1 and causing its translocation into the nucleus.
CuSO4 stimulation
Copper sulphate stimulation experiments were conducted in co-transfected HEK293T cells to determine if the baseline activity of the promoters MREwt and MREdada could be increased by incubation with 500 µM CuSO4 for four hours.
Figure 4: Representative microscopy images of HEK293T cells co-transfected with MTF-1-mRuby2-C2 and either promoter-reporter construct MREwt-EGFP-C2 (A,B, K5317008) or MREdada-EGFP-C2 (C,D, K5317011) before (A,C) or after (B,D) stimulation with 500 µM CuSO4 for four hours. Scale bar = 20 µm.
Unfortunately, no clear visual increase in fluorescence was detected for these promoters compared to the baseline signal. However, it is important to note that only small sample sections are presented here, and transfection efficiency may vary between treatments.
FACS analysis
FACS analysis enables the quantification of fluorescence signals, which is why they were used here to evaluate the increase in EGFP-positive cells in MTF1-mRuby2-C2 and one of the MRE site-contianing promoter-EGFP-C2 plasmid double-transfected cells depending on the copper sulphate concentration added to the medium for four hours. The results are presented in the bar chart in figure 5.
Figure 5: Quantitive validation by flow cytometry analysis. The percentage of cells expressing the fluorophore EGFP under the control of the tested MRE site-containing promoter is displayed as a function of various concentrations of copper sulfate across all four promoters with an total incubation period of four hours. The cells were pregated on the basis of their mRuby2-positivity. n=1.
It is evident that the MREa and MREdada promoters show an increase in expression, while the MREwt promoter exhibits no significant change, and MREd even shows a decrease in EGFP-expressing cells upon stimulation. Notably, the MREdada-containing promoter exhibited the highest increase in fluorescence signal. Overall, our synthetic promoters, MREa and MREdada, enable effective detection of copper sulfate compared to the wild-type MRE promoter.
References
Saydam, N., Georgiev, O., Nakano, M. Y., Greber, U. F., & Schaffner, W. (2001). Nucleo-cytoplasmic trafficking of metal-regulatory transcription factor 1 is regulated by diverse stress signals. The Journal of biological chemistry, 276(27), 25487–25495. https://doi.org/10.1074/jbc.M009154200
Tavera-Montañez, C., Hainer, S. J., Cangussu, D., Gordon, S. J. V., Xiao, Y., Reyes-Gutierrez, P., Imbalzano, A. N., Navea, J. G., Fazzio, T. G., & Padilla-Benavides, T. (2019). The classic metal-sensing transcription factor MTF1 promotes myogenesis in response to copper. FASEB journal: official publication of the Federation of American Societies for Experimental Biology, 33(12), 14556–14574. https://doi.org/10.1096/fj.201901606R
Wimmer, U., Wang, Y., Georgiev, O., & Schaffner, W. (2005). Two major branches of anti-cadmium defense in the mouse: MTF-1/metallothioneins and glutathione. Nucleic acids research, 33(18), 5715–5727. https://doi.org/10.1093/nar/gki881
| None |