Part:BBa_K5317009

4xMREa-EGFP

Usage and Biology

The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.

To increase the efficiency of the activated MTF-1-responsive promoter, we constructed a synthetic promoter with multiple MREa sites. Searle and colleagues described in 1985 that at least two MREa sites are necessary for the zinc-induced expression of the downstream gene, here herpes simplex virus thymidine kinase. They also showed that the positioning of the MREs in the promoter sequence had little effect on the promoter efficiency, but was increased with more MREa sites inserted. Therefore, we put a promoter together with four MREa sites positioned at the sites of the MREwt promoter (K5317003).

Cloning

Theoretical Part Design

Placing the 4xMREa-containing promoter upstream of the reporter gene EGFP allows the visualization of primarily metal-dependent activation of MTF-1.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Cloning

The promoter was synthesized and inserted by NEB HiFi DNA Assembly into the pEGFP-C2 backbone plasmid (K3338020) after its restriction enzyme digestion with AseI and NheI, generating the MREwt-EGFP cassette. The assembled plasmid is shown in figure 1.

Table1: Primers used to create matching overhangs on promoter amplicon to digested pEGFP-C2 backbone.

Primer name	Sequence
4xMREa_fw	CCGCCATGCATTAGTTATGCACACTGGCGCT
4xMREa_rev	TGGCGACCGGTAGCGGACGCTTAGAGGACAGC

Figure 1: Assembled vector map with 4xMREa-EGFP integrated into the pEGFP-C2 backbone.

Characterization

Transfection experiments in mammalian HEK293T cells assessed the promoter functionality, sensitivity, and specificity. First, the composite part carrying plasmid was introduced via transfection to establish a baseline of endogenous promoter activity before performing co-transfection experiments with the CMV-MTF1-mRuby2 carrying plasmid (composite part K5317012) under varying copper concentration for stimulation. The EGFP fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.

Single-transfection experiments

Figure 2: Single-transfected HEK293T cells with the 4xMREa-EGFP-C2 plasmid depicted no EGFP-signal under unstimulated conditions. Scale bar = 20 µm.

The single transfection with the 4xMREa-EGFP-C2 plasmid in HEK293T cells showed no baseline signal without the co-transfection with the CMV-MTF1-mRuby2 plasmid and no metal ion stimulation. The experiments allow conclusions about the sensitivity and specificity of the promoter under homeostatic conditions. Therefore, the generated promoter has no unspecific expression by for example other, under homeostatic conditions active, transcription factors. The possible endogenous expression of MTF-1 is also not enough to generate a fluorescent signal under unstimulated conditions.

Co-transfection experiments with MTF-1

To convert the presence of metal ions into a fluorescent signal, the co-transfection of the metal ion sensor protein MTF-1, which can then bind to the second induced plasmid, carrying the 4xMREa promoter, enables a signaling cascade resulting in the expression of EGFP. The successful double-transfection of as many cells as possible, in addition to the non- or only 4xMREa-EGFP-C2- or only MTF1-mRuby2-C2- transfected cells, is crucial for sensor functionality. Figure 3 clearly shows that some of the HEK293T cells successfully display both mRuby2 and EGFP signals intracellularly. The mRuby2 signal, which reflects the localization of MTF-1, shows a nuclear signal, whereas the EGFP shows a cytoplasmic signal as expected.

Figure 3: Representative microscopy images of HEK293T cells co-transfected with MTF1-mRuby2-C2 together with 4xMREa-EGFP-C2. MTF-1 depicts a nuclei-localized signal, the EGFP signal is cytoplasmatic. Shown are brightfield channels (left), fluorescence channels (images in the center), and an overlay of the channels (right).

A basal expression of the promoter-driven reporter fluorophore EGFP can be seen without metal stimulation. This is due to possible metal ions in the culture medium of the HEK293T cells that could interact with the MTF-1.

FACS analysis

FACS analysis enables the quantification of fluorescence signals, which is why they were used here to evaluate the increase in EGFP signal in MTF1-mRuby2-C2 and 4xMREa-EGFP-C2 double-transfected cells depending on the copper sulphate concentration added to the medium for four hours. The results are presented in the bar chart in figure 4.

Figure 4: Quantitive validation by flow cytometry analysis. The percentage of cells expressing the fluorophore EGFP under the control of the 4xMREa promoter is displayed as a function of various concentrations of copper sulfate incubated for four hours. The cells were pregated based on their mRuby2-positivity. n=1.

Although not continuous, a clear increase in the number of EGFP-expressing cells can be recognized with increasing copper sulphate concentration in the medium. Growing from approx. 14 % to approx. 21 % of EGFP-positive cells under stimulation with 0 µM or 500 µM CuSO₄, respectively. Even if complicated by high basal activity, the presence of copper sulphate can be detected with the 4xMREa promoter construct. However, it should be noted that the experiment could only be carried out once due to time constraints.

Reference

Searle, P. F., Stuart, G. W., & Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Molecular and cellular biology, 5(6), 1480–1489. https://doi.org/10.1128/mcb.5.6.1480-1489.1985