Part:BBa_K2992016
Pfdx-t14c from C. sporogenes
Promoter region from the ferredoxin gene of C. sporogenes with the corrected t14c substitution compared with Part: BBa_K2715002.
Usage and Biology
Pfdx is a strong constitutive promoter which regulates the ferredoxin gene in C. sporogenes. Ferredoxin is an iron-sulfur protein involved in central redox reactions occurring during the general metabolism of Clostridia. Pfdx was used in Nottingham’s 2018 iGEM project to drive the expression of various reporters (insert hyperlink). In our 2019 project, we sought to us Pfdx to drive the expression of our volatile and FAST reporter genes for predicting the production of botulinum neurotoxin following food manufacture. During our experimentation, we noted an erroneous c14t substitution exists in the 2018 construct which presumably occurred through a SNP in the 5’-cloning primer. The promoter region and 5’-UTR was also predicted using BPROM in last year’s entry. This year we have used experimental data from our group to ascertain the transcription start site and to differentiate between the promoter and 5’-UTR regions accordingly (Cañadas et al., 2019).
Characterisation
Characterisation of Pfdx with FAST in comparison with other Clostridium and Escherichia coli promoters.
One of the goals of goal of this experiment was to characterize the Pfdx promoter in a composite part (BBa_K2992043) with a new reporter protein, the Fluorescence-Activating and Absorption-Shifting Tag Protein (FAST). The part was characterized through a fluorescence assay in E. coli as well as in C. sporogenes. Fluorescence is reported as Molecule Equivalent Fluorescence per Particle (MEFL/particle) as per the recommendation of the iGEM measurement Hub.
Additionally, while preparing the assay we also discovered a mistake in the BBa K2715011 part sequence: this part was described as the native Pfdx promoter from C. sporogenes, but exhibited a point mutation compared to the Wild-Type strain (C14T). The mutation looked benign (190 bp away from START codon), but we decided to compare the registry part to the Wild-Type Pfdx sequence to prove that both the Wild-Type and the registry version of the Pfdx promoter were equivalent. The sequence of each part is given here for clarity, with the mismatch bolded:
>Pfdx (BBa_K2992016): gtgtagtagcctgCgaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagata
ggataatagaatccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt
>Bba_K2715011: gtgtagtagcctgTgaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagata
ggataatagaatccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt
It was assayed along with the following composite parts:
- BBa_K2992044
- BBa_K2992042
- BBa_K2992001 with this 5'UTR including a RBSBBa_K2992015 and the FAST reporter protein BBa_K2992000.
- BBa_K2992012 with this 5'UTR including a RBS BBa_K2992014 and the FAST reporter protein BBa_K2992000.
- BBa_K2715010, the 5' UTR BBa_K2715019, this RBS BBa_K2715009 and the FAST reporter protein BBa_K2992000.
- BBa_J23106, the 5' UTR BBa_K2715019, this RBS BBa_K2715009 and the FAST reporter protein BBa_K2992000.
The first observation from the expression of the FAST protein using different Clostridium and E. coli promoters is that FAST is a suitable reporter gene, both in E. coli and in Clostridium sporogenes. Indeed, quantifiable levels of fluorescence were recorded in between 6.3*103 MEFL/particle and 1.1*106 MEFL/particle. Pfdx is the strongest of the promoters tested in E. coli after Pthl, and the strongest in C. sporogenes.
Pfdx and Bba_K2715011 have equivalent expression levels (5.5*105 +- 0.9*105 MEFL/particle and 6*105 +-1*105 MEFL/particle respectively in C. sporogenes; 9*105 +- 1*105 105 MEFL/particle and 1.007*106 +-0.009*106 105 MEFL/particle respectively in E. coli). Statistical equivalence was not significant, but they were not stastically different either (p=0.779 in a two-tailed Welch t-test). In the absence of better data, we consider Pfdx and Bba_K2715011 to be interchangeable. Since our part “Pfdx” is the original, unmutated version of the ferredoxin promoter from C. sporogenes, the sequence of Bba_K2715011 documented in the registry of parts should be curated to match the native sequence of Pfdx.
For more characterisation details, please see the Results page.
https://2019.igem.org/Team:Nottingham/Results
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
References
Cañadas, I., Groothuis, D., Zygouropoulou, M., Rodrigues, R. and Minton, N. (2019). RiboCas: A Universal CRISPR-Based Editing Tool for Clostridium. ACS Synthetic Biology, 8(6), pp.1379-1390
Minton, N., Ehsaan, M., Humphreys, C., Little, G., Baker, J., Henstra, A., Liew, F., Kelly, M., Sheng, L., Schwarz, K. and Zhang, Y. (2016). A roadmap for gene system development in Clostridium. Anaerobe, 41, pp.104-112.
Zhang, Y., Xu, S., Chai, C., Yang, S., Jiang, W., Minton, N. and Gu, Y. (2016). Development of an inducible transposon system for efficient random mutagenesis inClostridium acetobutylicum. FEMS Microbiology Letters, 363(8), p.fnw065.
| None |