![](https://parts.igem.org/images/partbypart/icon_coding.png)
Part:BBa_E1010
**highly** engineered mutant of red fluorescent protein from Discosoma striata (coral)
monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm
Usage and Biology
Robert E. Campbell started with Discosoma RFP (DsRed) and evolved a faster folding, monomeric variant. See paper listed in source. Codon optimized for expression in bacteria (?? DE)
iGEM11_Uppsala-Sweden: Expression of chromoproteins. The images above show E coli constitutively expressing amilCP BBa_K592009 (blue), amilGFP BBa_K592010 (yellow) and RFP BBa_E1010 (red).
Peking iGEM 2016 has fused this part with triple spytag. The fused protein is participate in Peking’s polymer network. By adding this protein, the whole polymer network become visible in most conditions. If you want to learn more about Peking’s polymer network and the role of mRFP in this network, please click here https://parts.igem.org/Part:BBa_K1989004".
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 555
Illegal AgeI site found at 667 - 1000COMPATIBLE WITH RFC[1000]
Parts table
Protein data table for BioBrick BBa_E1010 automatically created by the BioBrick-AutoAnnotator version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Nucleotide sequence in RFC 10: (underlined part encodes the protein) ATGGCTTCC ... ACCGGTGCTTAATAACGCTGATAGTGCTAGTGTAGATCGC ORF from nucleotide position 1 to 675 (excluding stop-codon) | ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid sequence: (RFC 25 scars in shown in bold, other sequence features underlined; both given below)
| ||||||||||||||||||||||||||||||||||||||||||||||
Sequence features: (with their position in the amino acid sequence, see the list of supported features)
| ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid composition:
| ||||||||||||||||||||||||||||||||||||||||||||||
Amino acid counting
| Biochemical parameters
| |||||||||||||||||||||||||||||||||||||||||||||
Plot for hydrophobicity, charge, predicted secondary structure, solvent accessability, transmembrane helices and disulfid bridges | ||||||||||||||||||||||||||||||||||||||||||||||
Codon usage
| ||||||||||||||||||||||||||||||||||||||||||||||
Alignments (obtained from PredictProtein.org)
| ||||||||||||||||||||||||||||||||||||||||||||||
Predictions (obtained from PredictProtein.org) | ||||||||||||||||||||||||||||||||||||||||||||||
Subcellular Localization (reliability in brackets)
| Gene Ontology (reliability in brackets)
| |||||||||||||||||||||||||||||||||||||||||||||
Predicted features:
| ||||||||||||||||||||||||||||||||||||||||||||||
The BioBrick-AutoAnnotator was created by TU-Munich 2013 iGEM team. For more information please see the documentation. If you have any questions, comments or suggestions, please leave us a comment. |
//chassis/prokaryote/ecoli
//function/reporter
//function/reporter/fluorescence
//test
abs | |
biology | |
color | Red |
direction | Forward |
emission | 607 |
emit | 607 |
excitation | 584 |
excite | 584 |
kegg | |
lum | |
protein | mRFP1 |
swisspro | |
tag | None |