Difference between revisions of "Part:BBa C0062:Experience"

(→‎Modeling crosstalk)
(→‎Results)
Line 77: Line 77:
 
|}
 
|}
  
 +
=== Modeling crosstalk ===
 +
 +
Each experimental data set was fitted to an Hill function using the Least Absolute Residual method.
 +
 +
[[File:ETHZ_HillEq.png|center|200px]]
 +
<p>The fitting of the graphs was performed using the following equation :<br><br>
 +
rFluo = the relative fluorescence (absolute measured fluorescence value over OD)[a.u.]<br>
 +
a    = basal expression rate [a.u.](“leakiness”)<br>
 +
b = maximum expression rate [a.u.]("full induction")<br>
 +
n      = Hill coefficient (“cooperativity”)<br>
 +
K<sub>m</sub>  = Half-maximal effective concentration (“sensitivity”)<br>
 +
[AHL]= AHL concentration [nM]</p>
 +
<br clear="all"/>
 +
 +
{| border="1" class="wikitable" style="margin: 1em auto 1em auto;text-align:center;"
 +
|+ Parameters of HillFunction for crosstalk with LuxR (with 95% confidence bounds)
 +
!
 +
! [[3OC6HSL|3OC6-HSL]]
 +
! [[AHL|3OC12-HSL]]
 +
! [[AHL|C4-HSL]]
 +
|-
 +
! [https://parts.igem.org/Part:BBa_R0062 Plux]
 +
| a = 1043 (966.8, 1139) [a.u.]<br> n = 0.89 (0.79, 0.99)<br> Km = 0.1892 (0.1392, 0.2391) [nM]<br>b = 2.129e4 (2.065e4, 2.192e4) [a.u.]<br>
 +
| a = 900.5 (882, 918.9) [a.u.]<br>n = 1.049 (0.9976, 1.1)<br> Km = 78.32 (73.18, 83.47) [nM]<br> b = 1.866e4 (1.834e4, 1.899e4) [a.u.]<br>
 +
| No crosstalk
 +
|-
 +
! [https://parts.igem.org/Part:BBa_R0079 Plas]
 +
| a = 3.996 (0, 9.185) [a.u.]<br> n = 0.5198 (0.2879, 0.7517)<br> Km = 382.3 (0, 1206) [nM]<br>b = 261 (155.5, 366.5) [a.u.]<br>
 +
| No crosstalk
 +
| No crosstalk
 +
|-
 +
! [https://parts.igem.org/Part:BBa_I14017 Prhl]
 +
| No crosstalk
 +
| No crosstalk
 +
| No crosstalk
 +
|}
  
 
|}
 
|}

Revision as of 13:45, 24 October 2014

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_C0062

User Reviews

UNIQfbd11ea65701daf9-partinfo-00000000-QINU


••••

ETH Zurich 2014

Characterization of the promoter's sensitivity to 3OC6-HSL depending on LuxR concentration

Background information

Results

Figure 1

Characterization of two-order crosstalk

Background information

First-order crosstalk

First Level crosstalk: LuxR binds to different HSL and activates the promoter Plux

ETH Zurich 1crosstalkPlux.png

Second Level crosstalk: LuxR binds to 3OC6-HSL, its natural HSL, and activates different promoter

ETH Zurich 2crosstralkRlux.png

Second order crosstalk: Combination of both cross-talk levels

Other regulatory proteins, like LuxR, bind to different HSL and activates the promoter.

Results

Table 1 Crosstalk matrix for the regulator LuxR (BBa_C0062)

In all the measurements conducted to create this matrix the regulator LuxR was the basis and was induced in six different variations shown.

ETH Zurich 2014 qs-table Corner LuxR.png ETH Zurich 2014 qs-table 3OC6-HSL.png ETH Zurich 2014 qs-table 3OC12-HSL.png ETH Zurich 2014 qs-table C4-HSL.png
ETH Zurich 2014 qs-table pLux.png ETH Zurich 2014 qs-table PluxRef.png ETH Zurich 2014 qs-table PluxLuxRLasAHL.png ETH Zurich 2014 qs-table PluxLuxRRhlAHL.png
ETH Zurich 2014 qs-table pLas.png ETH Zurich 2014 qs-table PlasLuxRLuxAHL.png ETH Zurich 2014 qs-table PlasLuxRLasAHL.png ETH Zurich 2014 qs-table PlasLuxRRhlAHL.png
ETH Zurich 2014 qs-table pRhl.png ETH Zurich 2014 qs-table PrhlLuxRLuxAHL.png ETH Zurich 2014 qs-table PrhlLuxRLasAHL.png ETH Zurich 2014 qs-table PrhlLuxRRhlAHL.png

Modeling crosstalk

Each experimental data set was fitted to an Hill function using the Least Absolute Residual method.

ETHZ HillEq.png

The fitting of the graphs was performed using the following equation :

rFluo = the relative fluorescence (absolute measured fluorescence value over OD)[a.u.]
a = basal expression rate [a.u.](“leakiness”)
b = maximum expression rate [a.u.]("full induction")
n = Hill coefficient (“cooperativity”)
Km = Half-maximal effective concentration (“sensitivity”)
[AHL]= AHL concentration [nM]


Parameters of HillFunction for crosstalk with LuxR (with 95% confidence bounds)
3OC6-HSL 3OC12-HSL C4-HSL
Plux a = 1043 (966.8, 1139) [a.u.]
n = 0.89 (0.79, 0.99)
Km = 0.1892 (0.1392, 0.2391) [nM]
b = 2.129e4 (2.065e4, 2.192e4) [a.u.]
 a = 900.5 (882, 918.9) [a.u.]
n = 1.049 (0.9976, 1.1)
Km = 78.32 (73.18, 83.47) [nM]
b = 1.866e4 (1.834e4, 1.899e4) [a.u.]
 No crosstalk
Plas a = 3.996 (0, 9.185) [a.u.]
n = 0.5198 (0.2879, 0.7517)
Km = 382.3 (0, 1206) [nM]
b = 261 (155.5, 366.5) [a.u.]
 No crosstalk No crosstalk
Prhl No crosstalk No crosstalk No crosstalk


•••••

SUN(Tsinghua)

Part was sequenced and functional. LuxR was used in our Portable Pathogen Detector.

;
•••••

wmholtz

Using this part, I have successfully constructed and tested a quorum sensing circuit in E. coli.

;
•••••

Youri

This part was used and tested as a subpart in K546000, K546001, K546002, K546003, K546005 and K546546. This part functioned in all cases.

;

Kevin (iGEM Braunschweig 2013)

The plasmid pSB1C3 BBa_C0062 from the 2013 distribution Kit was transformed in E. coli XL1 BlueMRF. Sequencing with standard verification primer VF2 confirmed matching sequence of backbone DNA up to the EcoRI restriction site. The rest of the sequence (not shown) does not match the registry entry. 

                   96                                             145
pSB1C3 LuxR   (96) GAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATT
  C0062 VF2    (1) GAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATT

                   146                                            195
pSB1C3 LuxR  (146) TCTGGAATTCGCGGCCGCTTCTAGAGATGAAAAACATAAATGCCGACGAC
  C0062 VF2   (51) TCTGGAATTCGACGCAA-TGGGTGCGCTGTCTACTAAATACAACGACACC

                   196                                            245
pSB1C3 LuxR  (196) ACATACAGAATAATTAATAAAATTAAAGCTTGTAGAAGCAATAATGATAT
  C0062 VF2  (100) CCGGAAAAAGCCTCCCGTACTTACGACGCTCACCGTGACGGTTTCGTTAT

                   246
pSB1C3 LuxR  (246) TAATCAATGC...
  C0062 VF2  (150) CGCTGGCGGC...


A restriction assay (Figure 1) showed that the sequenced part has no XbaI restriction site following the EcoRI site indicating another part in front of BBa_C0062 with a length of at least 1000 bp.

Figure 1: restriction assay of BBa_C0062 with the indicated restriction enzymes

;

UNIQfbd11ea65701daf9-partinfo-00000007-QINU