Difference between revisions of "Part:BBa E1010:Experience"

(→‎User Reviews)
(→‎User Reviews)
Line 46: Line 46:
 
<I>HIT-Harbin</I>
 
<I>HIT-Harbin</I>
 
|width='60%' valign='top'|
 
|width='60%' valign='top'|
−
<p>1)Measuring absorbance of RFP</p>
+
<p></p>1)Measuring absorbance of RFP
−
<p>We grew E.coli without device(BBa_J04450) and bacteria with parts BBa_J04450 in same volume of LB until
+
<p>We grew bacteria without device(BBa_J04450) and bacteria with parts BBa_J04450 in  
  
−
stationary phase. Taking E.coli without device as background, we measured the
+
same volume until stationary phase. Taking bacteria without device as background, we  
  
−
absorbance of bacteria with BBa_J04450 (RFP have two absorption peak, 504nm and 585nm figure1).But
+
measured the absorbance of bacteria with our device (the max absorption peak is
  
−
absorbance in 504nm and 585nm is higher than 1,which present a bad linear relation between
+
504nm).But absorbance in 504nm is higher than 1,which present a bad linear relation  
  
−
absorbance and concentraton. RFP has absorption in 450nm,and absorbance is between 0.1
+
between absorbance and concentraton. RFP has absorption in 450nm,and absorbance is  
  
−
and 1(better linear relation).Occasionally, we find a RFP standard curve under 450nm
+
between 0.1 and 1(better linear relation).Occasionally, we find a RFP standard curve  
  
−
on the web.Before the mensuration, we diluted the two groups according to table1. We
+
under 450nm on the web.Before the mensuration, we diluted the two groups according to  
−
 
+
−
took the mean of two measures as the useful data. </p>
+
  
 +
table1. We took the mean of two measures as the useful data. </p>
 +
<div align="center">
 
"https://static.igem.org/mediawiki/2013/8/8f/Experiment8.png"
 
"https://static.igem.org/mediawiki/2013/8/8f/Experiment8.png"
 
<p>Fig.1 RFP absorbance varying with wave length</p>
 
<p>Fig.1 RFP absorbance varying with wave length</p>
Line 69: Line 69:
 
"https://static.igem.org/mediawiki/2013/7/74/Experiment9.png"
 
"https://static.igem.org/mediawiki/2013/7/74/Experiment9.png"
 
<p>Fig 2. The relationship between RFP concentration and absorbance(OD450)</p>
 
<p>Fig 2. The relationship between RFP concentration and absorbance(OD450)</p>
 +
</div>
  
−
 
+
<p>2)The actual relationship between RFP concentration and absorbance</p>
−
<p></p>2)The actual relationship between RFP concentration and absorbance
+
<div align="center">
−
 
+
 
"https://static.igem.org/mediawiki/2013/8/88/Experiment10.png"
 
"https://static.igem.org/mediawiki/2013/8/88/Experiment10.png"
 
<p>Fig 3. RFP standard curve obtain from the web
 
<p>Fig 3. RFP standard curve obtain from the web
 +
</div>
 
<p></p>Through the standard curve, we can convert the relative concentration to the  
 
<p></p>Through the standard curve, we can convert the relative concentration to the  
  
Line 85: Line 86:
  
 
curve is reliable, our calculated result of RFP will be precise.
 
curve is reliable, our calculated result of RFP will be precise.
 +
 
|};
 
|};
  

Revision as of 09:26, 27 September 2013

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

RANDOM SEQUENCE FOUND WITHIN PART

CGCTGATAGTGCTAGTGTAGATCGC is found after the RFP stop codon and before the BioBricks suffix. Should not affect transcription or translation of RFP, but good to keep note of it especially in analyzing sequencing results. (KP of siGEM)

  • Please note that the above sequence is the old "barcode" sequence added to all of the original CDSs in the early BioBrick part collections. I.e., it's not a random sequence. See https://parts.igem.org/cgi/htdocs/barcodes.cgi for more information (D. Endy).
    • FURTHER NOTE The Registry is not displaying barcodes on any of the original parts. The presented sequence information is wrong. This is a serious bug in the Registry that need to be fixed (D. Endy). Drew 14:34, 1 November 2010 (UTC)

Applications of BBa_E1010

Error creating thumbnail: Invalid thumbnail parameters

User Reviews

UNIQae752c55b6835cc7-partinfo-00000000-QINU

•••••

Immudzen

As part of the 2013 CU Boulder project we worked on separating RFP from AmilCP and during that process we ran into a problem that the fluorescence of RFP is too close to the absorption of AmilCP to tell them apart. What we ended up doing was measuring the spectrum of RFP from 400nm to 600nm.

Cu RFP.png

What we found is that RFP has a secondary absorbance peak at 502nm which is well clear of AmilCP. Under the devices we had access to this secondary peak also remained in the linear region of our device over a much wider concentration range.

We also found that when running on an agarose gel RFP will run down on the gel while AmilCP runs up on the gel.

;
•••••

HIT-Harbin

1)Measuring absorbance of RFP

We grew bacteria without device(BBa_J04450) and bacteria with parts BBa_J04450 in same volume until stationary phase. Taking bacteria without device as background, we measured the absorbance of bacteria with our device (the max absorption peak is 504nm).But absorbance in 504nm is higher than 1,which present a bad linear relation between absorbance and concentraton. RFP has absorption in 450nm,and absorbance is between 0.1 and 1(better linear relation).Occasionally, we find a RFP standard curve under 450nm on the web.Before the mensuration, we diluted the two groups according to table1. We took the mean of two measures as the useful data.

"Experiment8.png"

Fig.1 RFP absorbance varying with wave length

Table 1 Dilution of Two groups of bacteria

"Experiment7.png" "Experiment9.png"

Fig 2. The relationship between RFP concentration and absorbance(OD450)

2)The actual relationship between RFP concentration and absorbance

"Experiment10.png"

Fig 3. RFP standard curve obtain from the web </div> <p>

Through the standard curve, we can convert the relative concentration to the

absolute concentration, and finally get the relationship between IPTG concentration

and RFP concentration.

Compared to crushing cells to separate RFP, our method is simpler and easy to

practice. Moreover, our relative concentration curve is credible. If the standard

curve is reliable, our calculated result of RFP will be precise.

;
•••••

Carnegie_Mellon 2013

Characterization of the Photostability of mRFP1

Photobleaching curve of mRFP1 with a HBO100 mercury-arc lamp"

XL10 Ultracompetent cells were transformed with BBa_E1010 cloned with BBa_B0034 as the RBS and BBa_R0010 as the wild-type lac promoter and induced overnight with IPTG.The overnight was bleached for 180 minutes with HBO100 (100W Mercury-arc lamp). Fluorescence data was taken using a Tecan Safire II with the parameters shown in Table 3. Fluorescence values are shown in Table 4.

Table 3 Tecan Safire II Parameters
Excitation (nm)585
Emission (nm)610
Excitation bandwidth (nm)10
Emission bandwidth (nm)10
Gain63
Number of reads10
Integration Time (microseconds)40


Table 4 Shows the fluorescence data over time during photobleaching.
Time (minutes)Fluorescence (RFU)
048694
2043083
4036842
6030239
8031281
10025273
12021467
14018081
16015251
18014427
••••

KAIST_iGEM_2012

Figure 1. E.coli strain MG1655 expressing BBa_E1010 under control of BBa_K907005 after overnight culture. 3mL culture with M9 media in 14ml round bottom tube(left), and centrifuged cells in eppendorf tube(right). The expression of BBa_1010 is clearly observed with naked eye after overnight culture.


We recommend you to measure the emission wavelenth at 619nm. Because the maximum excitaion and emission wavelenth are too close to each other, the signal overflows. You can get more precise results with our recommendations.
BBa_E1010 was successfully used to produce mRFP in E.coli strain MG1655 in LB or M9 minimal media under the control of promoter-BBa_J23119 and RBS-BBa_B0034 in the Dual Phase Protein Generator(mRFP default), BBa_K907005


;
•••

DTU_igem_2010

Characterization of RFP BBa_E1010
We have characterized RFP BBa_E1010 in two different chassis to test the compatibility and the possible range of expressions before limitations in the cell metabolism.

Method
We have made constructs with a synthetic promoter library (SPL) in front of the E1010, by using BBa_I13507 and the plasmid backbone pSB3T5. For information on design of an SPL compatible with the BB standard see [http://bbf.openwetware.org/RFC.html#BBF_RFC_63:_DTU_Synthetic_Promoter_Library_Standard BBF RFC63]. We have benchmarked the relative promoter strength range achieved from the SPL to the standard promoter BBa_J23101, by calculating the relative promoter strength in vivo as suggested in [http://bbf.openwetware.org/RFC.html#BBF_RFC_19:_Measuring_the_Activity_of_BioBrick.E2.84.A2_Promoters_Using_an_In_Vivo_Reference_Standard BBF RFC 19]. For further explanation on methods see our [http://2010.igem.org/Team:DTU-Denmark iGEM_DTU_2010 wiki].

Results
We show that the RFP E1010 can be expressed with the following results

  • In XL1blue with an RPU range form 0 to at least 1,13 RPU.
  • In DHA5&alpha with an RPU range from 0 to 1,35 RPU.
Graph2 XL1BLUE illustrates the variation in promoter strengths of the SPL mapped against the reference promoters. PM corresponds to BBa_J23101, PS corresponds to BBa_J23100 and PW corresponds to BBa_J23116.
Graph3 XL1BLUEillustrates the specific activities of the SPL promoters ranked together with the reference promoters.
Graph4 DH5aillustrates the variation in promoter strengths of the SPL mapped against the reference promoters. PM corresponds to BBa_J23101, PS corresponds to BBa_J23100 and PW corresponds to BBa_J23116.
Graph5 DH5a illustrates the specific activities of the SPL promoters ranked against the reference promoters.

Table 1 shows the specific activities and RPUs calculated for all the SPL constructs run in BioLector in XL1-blue
ConstructSpecific ActivityRPU
BBa_J231010.07951.00
SPL_RFP010.005780.0727
SPL_RFP020.04180.526
SPL_RFP030.06120.770
SPL_RFP04-0.00027-0.00340
SPL_RFP050.04180.526
SPL_RFP060.08561.08
SPL_RFP070.01340.168
SPL_RFP080.05340.672
SPL_RFP090.06380.803
SPL_RFP100.002600.0327
SPL_RFP110.09001.13
SPL_RFP120.06000.755
SPL_RFP130.07540.949
SPL_RFP140.007950.100
SPL_RFP160.009590.121


Table 2 shows the specific activities and RPUs calculated for all the SPL constructs run in BioLector in DH5alpha
ConstructSpecific ActivityRPU
BBa_J231010.07121.00
SPL_RFP-D010.07151.00
SPL_RFP-D020.09591.35
SPL_RFPD-030.07811.10
SPL_RFPD-040.05310.746
SPL_RFPD-050.07321.03
SPL_RFPD-060.05520.775
SPL_RFPD-070.03580.503
SPL_RFPD-080.06680.938
SPL_RFPD-090.02540.357
SPL_RFPD-100.01650.231
SPL_RFPD-11-0.00284-0.399
SPL_RFPD-120.002760.0387
SPL_RFPD-130.07761.09
SPL_RFPD-140.00180.0253
SPL_RFPD-150.003020.0424
;

Antiquity

This review comes from the old result system and indicates that this part did not work in some test.

Nkessler

We successfully used this part for a read out system, e.g. in BBa_K389016. Additionally we compared it with a luciferase: BBa_K389004.

UNIQae752c55b6835cc7-partinfo-00000012-QINU