Difference between revisions of "Part:BBa E1010:Experience"
(→User Reviews) |
(→User Reviews) |
||
Line 29: | Line 29: | ||
<I>KAIST_iGEM_2012</I> | <I>KAIST_iGEM_2012</I> | ||
|width='60%' valign='top'| | |width='60%' valign='top'| | ||
− | [[image: KAIST_iGEM_2012_Experience_BBa_E1010.PNG|center|thumb|400px|'''Figure 1. E.coli strain MG1655 expressing BBa_E1010 under control of <partinfo>BBa_K907005</partinfo> after overnight culture. 3mL culture with M9 media in 14ml round bottom tube(left), and centrifuged cells in eppendorf tube(right)''' The expression of BBa_1010 is clearly observed with naked eye after overnight culture.]] | + | [[image: KAIST_iGEM_2012_Experience_BBa_E1010.PNG|center|thumb|400px|'''Figure 1. E.coli strain MG1655 expressing BBa_E1010 under control of <partinfo>BBa_K907005</partinfo> after overnight culture. 3mL culture with M9 media in 14ml round bottom tube(left), and centrifuged cells in eppendorf tube(right).''' The expression of BBa_1010 is clearly observed with naked eye after overnight culture.]] |
<br><partinfo>BBa_E1010</partinfo> was successfully used to produce mRFP in E.coli strain MG1655 in LB or M9 minimal media under the control of promoter-<partinfo>BBa_J23119</partinfo> and RBS-<partinfo>BBa_B0034</partinfo> in the Dual Phase Protein Generator(mRFP default), <partinfo>BBa_K907005</partinfo> | <br><partinfo>BBa_E1010</partinfo> was successfully used to produce mRFP in E.coli strain MG1655 in LB or M9 minimal media under the control of promoter-<partinfo>BBa_J23119</partinfo> and RBS-<partinfo>BBa_B0034</partinfo> in the Dual Phase Protein Generator(mRFP default), <partinfo>BBa_K907005</partinfo> | ||
Revision as of 23:29, 26 September 2012
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
RANDOM SEQUENCE FOUND WITHIN PART
CGCTGATAGTGCTAGTGTAGATCGC is found after the RFP stop codon and before the BioBricks suffix. Should not affect transcription or translation of RFP, but good to keep note of it especially in analyzing sequencing results. (KP of siGEM)
- Please note that the above sequence is the old "barcode" sequence added to all of the original CDSs in the early BioBrick part collections. I.e., it's not a random sequence. See https://parts.igem.org/cgi/htdocs/barcodes.cgi for more information (D. Endy).
- FURTHER NOTE The Registry is not displaying barcodes on any of the original parts. The presented sequence information is wrong. This is a serious bug in the Registry that need to be fixed (D. Endy). Drew 14:34, 1 November 2010 (UTC)
Applications of BBa_E1010
User Reviews
UNIQ8618bb44d3f24bc0-partinfo-00000000-QINU
••••
KAIST_iGEM_2012 |
Figure 1. E.coli strain MG1655 expressing BBa_E1010 under control of BBa_K907005 after overnight culture. 3mL culture with M9 media in 14ml round bottom tube(left), and centrifuged cells in eppendorf tube(right). The expression of BBa_1010 is clearly observed with naked eye after overnight culture.
|
•••
DTU_igem_2010 |
Characterization of RFP BBa_E1010 Method Results
|
Antiquity |
This review comes from the old result system and indicates that this part did not work in some test. |
No review score entered. Nkessler |
We successfully used this part for a read out system, e.g. in BBa_K389016. Additionally we compared it with a luciferase: BBa_K389004. |
UNIQ8618bb44d3f24bc0-partinfo-0000000C-QINU