Difference between revisions of "Promoters/Catalog/B. subtilis/Repressible"
| Line 1: | Line 1: | ||
[[Image:NegativePromoter.png|right|200px]] | [[Image:NegativePromoter.png|right|200px]] | ||
| − | + | The promoters here are ''B. subtilis'' promoters that are '''negatively regulated''' meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters. | |
<br style="clear:both" /> | <br style="clear:both" /> | ||
| − | ==Repressible ''B. subtilis'' σ<sup>A</sup> promoters== | + | ===Repressible ''B. subtilis'' σ<sup>A</sup> promoters=== |
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' σ<sup>A</sup> RNAP]]. σ<sup>A</sup> is the major ''B. subtilis'' sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).<br> | This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' σ<sup>A</sup> RNAP]]. σ<sup>A</sup> is the major ''B. subtilis'' sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).<br> | ||
<parttable>promoter_subtilis_negative_sigmaA</parttable> | <parttable>promoter_subtilis_negative_sigmaA</parttable> | ||
| − | ==Repressible ''B. subtilis'' σ<sup>B</sup> promoters== | + | ===Repressible ''B. subtilis'' σ<sup>B</sup> promoters=== |
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' σ<sup>B</sup> RNAP]]. σ<sup>B</sup> is the major stationary phase ''E. coli'' sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation. <br> | This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''B. subtilis'' σ<sup>B</sup> RNAP]]. σ<sup>B</sup> is the major stationary phase ''E. coli'' sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation. <br> | ||
Revision as of 00:39, 13 December 2008
The promoters here are B. subtilis promoters that are negatively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.
Repressible B. subtilis σA promoters
This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_K090501 | Gram-Positive IPTG-Inducible Promoter | . . . tggaattgtgagcggataacaattaagctt | 107 | 2054 | It's complicated | ||
| BBa_K143014 | Promoter Xyl for B.subtilis | . . . agtttgtttaaacaacaaactaataggtga | 82 | 2112 | Not in stock | ||
| BBa_K143015 | Promoter hyper-spank for B. subtilis | . . . aatgtgtgtaattgtgagcggataacaatt | 101 | 2527 | Not in stock |
Repressible B. subtilis σB promoters
This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.
There are no parts for this table