Difference between revisions of "Part:BBa K1722002"

 
(14 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
__NOTOC__
 
__NOTOC__
<partinfo>BBa_K1722002 short</partinfo>
+
<html>
 
+
<img style="width:10%" src="https://static.igem.org/mediawiki/2015/2/2c/SZU_China_igem_logo.png"/
 +
</html>
 +
{| style="color:black" cellpadding="5" cellspacing="1" border="3" align="right"
 +
! colspan="2" style="background:#d7474e;"|hTERT
 +
|-
 +
|'''Function'''
 +
|Promter
 +
|-
 +
|'''Use in'''
 +
|Cancer cells
 +
|-
 +
|'''RFC standard'''
 +
|[https://parts.igem.org/Help:Assembly_standard_10 RFC 10]
 +
|-
 +
|'''Backbone'''
 +
|[https://parts.igem.org/Help:Plasmid_Backbones pSB1C3]
 +
|-
 +
|'''Submitted by'''
 +
|[http://2015.igem.org/Team:SZU_China SZU_China 2015]
 +
|}
 +
=====<partinfo>BBa_K1722002 short</partinfo>=====
 
hTERT is a tumor specific promoter which is short for human telomerase reverse transcriptase. The human telomerase enzyme complex consists of human telomerase reverse transcriptase(TERT), telomerase RNA(TR) and dyskerin(DKCI).<sup>[1]</sup> This class of enzyme can catalyze the adding of (TTAGGG)n to the 3' end of telomeres to elongate the telomeres, thus prolonging cells' life. Researches show that the telomerase activity is based mostly on the expression level of TERT instead of that of TR and TEP. High telomerase activities are tested on most high proliferation cells such as tumor cells and stem cells. The core region of hTERT promoter lies on the 181bp sequence upstream of transcriptional start site, involving several binding sites for transcriptional factors, like sp1, cmyc, p53 and mad1. Researches show that hTERT promoters are activated in tumor cells that are telomerase positive while being inhibited in normal cells that are telomerase negative, which indicates that hTERT promoter may specifically target at tumor cells. Gu et al found the transcriptional activity of CMV promoter was almost 500 times higher than that of hTERT promoter in normal cells. However, the magnification shrinked to only 5-20 in tumor cells.
 
hTERT is a tumor specific promoter which is short for human telomerase reverse transcriptase. The human telomerase enzyme complex consists of human telomerase reverse transcriptase(TERT), telomerase RNA(TR) and dyskerin(DKCI).<sup>[1]</sup> This class of enzyme can catalyze the adding of (TTAGGG)n to the 3' end of telomeres to elongate the telomeres, thus prolonging cells' life. Researches show that the telomerase activity is based mostly on the expression level of TERT instead of that of TR and TEP. High telomerase activities are tested on most high proliferation cells such as tumor cells and stem cells. The core region of hTERT promoter lies on the 181bp sequence upstream of transcriptional start site, involving several binding sites for transcriptional factors, like sp1, cmyc, p53 and mad1. Researches show that hTERT promoters are activated in tumor cells that are telomerase positive while being inhibited in normal cells that are telomerase negative, which indicates that hTERT promoter may specifically target at tumor cells. Gu et al found the transcriptional activity of CMV promoter was almost 500 times higher than that of hTERT promoter in normal cells. However, the magnification shrinked to only 5-20 in tumor cells.
  
 
So in this study, we choose hTERT as a promoter to specifically recognise cancer cells to express the downstream effector. We constructed hTERT and GFP in the same plasmid and inserted the plasmid into T24, a bladder cancer cell line, to test if hTERT can be activated inside the cell. Luckily, we saw green fluorescent light using confocal laser scanning microscopy.
 
So in this study, we choose hTERT as a promoter to specifically recognise cancer cells to express the downstream effector. We constructed hTERT and GFP in the same plasmid and inserted the plasmid into T24, a bladder cancer cell line, to test if hTERT can be activated inside the cell. Luckily, we saw green fluorescent light using confocal laser scanning microscopy.
  
<!-- Add more about the biology of this part here
+
hTERT is 454bp in length. <b>Fig. 1</b> shows the DNA sequence of hTERT is successfully amplified by PCR from psi-Check2 vector. From this electrophoretogram, we can see the brightness of hTERT PCR product is rather high compared with DNA Marker, which indicates that the PCR product of hTERT is in a high concerntration.
===Usage and Biology===
+
  
<!-- -->
+
<html>
<span class='h3bb'>Sequence and Features</span>
+
<figure style="text-align: center"><img style="width:30%" src="https://static.igem.org/mediawiki/2015/1/14/Tert_pcr3.png"/><figcaption style="text-align:center"><b>Figure 1.</b> Electrophoretic analysis of PCR produution of hTERT promoter from psi-Check2. <figcaption style="text-align:center">(1:PCR production 2:DL2000 DNA Marker)</figcaption></figure>
<partinfo>BBa_K1722002 SequenceAndFeatures</partinfo>
+
  
==='''Design Notes'''===
+
</html>
We designed the following primers and amplified hUPII promoter from the vector psi-Check2:
+
  
CCGGAATTCATCGGGTGATCAGTACTCC(up)
+
After ligating hTERT and pSB1C3, we transfected the new pasmid being constructed into Ecoli and selected those Ecoli with Chl resistence. Using these Ecoli as templet, we amplified hTERT from pSB1C3,<b>(Fig. 2)</b> which means we had successfly construacted the pSB1C3-hTERT plasmid.
TGCACTGCAGACTAGTACTGAGCTGTGAGGT(down)
+
<html>
  
By incorporating these primers into hUPII promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.
+
<figure style="text-align: center"><img style="width:30%" src="https://static.igem.org/mediawiki/2015/b/b5/Tert_pcr5.png"/><figcaption style="text-align:center"><b>Figure 2.</b> Electrophoretic analysis of PCR product of hTERT promoter from pSB1C3. <figcaption style="text-align:center">(1:DL2000 DNA Marker 2:PCR product)</figcaption></figure>
  
 +
</html>
  
==='''Source'''===
+
We then performed single digest(EcoRI) and double digest(EcoRI & PstI) to identify our pSB1C3-hTERT plasmid.<b>(Fig. 3)</b> From the eletrophoretogram, we have two electrophoresis strips at about 454bp and 2070bp, which are exactly the length of hTERT and pSB1C3, respectively in Track 1 and a strip at about 2524bp in Track 2. From this enzyme cutting result, we could make sure the Gene sequence of hTERT succeeded in being constructed into pSB1C3 vector.
 +
<html>
  
hUPII gene was achieved from Shenzhen Second People's Hospital. We read a scientific treatise talking about targeted therapy of bladder cancer written by a doctor in Shenzhen Second People's Hospital and tried to seek cooperation with them. Fortunately, they agree to provide us hUPII with psi-Check2 as its vector.
+
<figure style="text-align: center"><img style="width:30%" src="https://static.igem.org/mediawiki/2015/f/fd/Tert%E9%85%B6%E5%88%87_2015-09-04_18_%E6%97%B6_12_%E5%88%86_-.jpg"/><figcaption style="text-align:center"><b>Figure 3.</b> Identification of recombinant plasmids pSB1C3-hTERT by one and two restriction enzymes. <figcaption style="text-align:center">[ 1:pSB1C3-hTERT double digest(EcoRI and PstI) 2:pSB1C3-hTERT single digest(EcoRI) 5:DL2000 DNA Marker]</figcaption></figure>
  
+
</html>
 +
 
 +
<!-- Add more about the biology of this part here
 +
===Usage and Biology===
 +
 
 +
<!-- -->
 +
<span class='h3bb'>Sequence and Features</span>
 +
<partinfo>BBa_K1722002 SequenceAndFeatures</partinfo>
  
==='''References'''===
+
===Design Notes===
 +
We designed the following primers and amplified hTERT promoter from the vector psi-Check2:Up: CCGGAATTCGGCACCTCCCTCGGGTTAG Down: TGCACTGCAGACTAGTCGCGTGGGTGGCCG. By incorporating these primers into hTERT promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.
  
[1]Wu XR, Lin JH, Walz T, et al. Mammalian uroplakins, a group of highly conserved urothelial differentiation related membrane    proteins. J Biol Chem. 1994;269:13716–13724.
+
===Source===
  
[2]Yuasa T, Yoshiki T, Isono T, et al. Expression of transitional cell specific genes uroplakin Ia and II in bladder cancer detection of circulating cancer cells in the peripheral blood of metastatic patients. Int J Urol. 1999;6:286–292.
+
The telomerase reverse transcriptase promoter can be found in human cancer cells. In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, the verification of our system's function was also carried out in Shenzhen Second People's Hospital.
  
[3]Moll R, Wu XR, Lin JH, Sun TT. Uroplakins specific
+
===References===
membrane proteins of urothelial umbrella cells as histological markers of metastatic transitional cell carcinomas. Am
+
[1] Cohen S, Graham M, Lovrecz G, Bache N, Robinson P, Reddel R (2007). "Protein composition of catalytically active human telomerase from immortal cells". Science 315 (5820): 1850–3.
J Pathol. 1995;147:1383–1397.
+
  
[4]Zhu H J, Zhang ZQ, Zeng XF, et al. Cloning and analysis of human uroplakin II promoter and its ap plication for gene
 
therapy in bladder cancer[J] Cancer Gene Ther, 2004, 11: 263-272
 
  
  

Latest revision as of 14:15, 17 September 2015

hTERT
Function Promter
Use in Cancer cells
RFC standard RFC 10
Backbone pSB1C3
Submitted by [http://2015.igem.org/Team:SZU_China SZU_China 2015]
hTERT is a tumor specific promoter.

hTERT is a tumor specific promoter which is short for human telomerase reverse transcriptase. The human telomerase enzyme complex consists of human telomerase reverse transcriptase(TERT), telomerase RNA(TR) and dyskerin(DKCI).[1] This class of enzyme can catalyze the adding of (TTAGGG)n to the 3' end of telomeres to elongate the telomeres, thus prolonging cells' life. Researches show that the telomerase activity is based mostly on the expression level of TERT instead of that of TR and TEP. High telomerase activities are tested on most high proliferation cells such as tumor cells and stem cells. The core region of hTERT promoter lies on the 181bp sequence upstream of transcriptional start site, involving several binding sites for transcriptional factors, like sp1, cmyc, p53 and mad1. Researches show that hTERT promoters are activated in tumor cells that are telomerase positive while being inhibited in normal cells that are telomerase negative, which indicates that hTERT promoter may specifically target at tumor cells. Gu et al found the transcriptional activity of CMV promoter was almost 500 times higher than that of hTERT promoter in normal cells. However, the magnification shrinked to only 5-20 in tumor cells.

So in this study, we choose hTERT as a promoter to specifically recognise cancer cells to express the downstream effector. We constructed hTERT and GFP in the same plasmid and inserted the plasmid into T24, a bladder cancer cell line, to test if hTERT can be activated inside the cell. Luckily, we saw green fluorescent light using confocal laser scanning microscopy.

hTERT is 454bp in length. Fig. 1 shows the DNA sequence of hTERT is successfully amplified by PCR from psi-Check2 vector. From this electrophoretogram, we can see the brightness of hTERT PCR product is rather high compared with DNA Marker, which indicates that the PCR product of hTERT is in a high concerntration.

Figure 1. Electrophoretic analysis of PCR produution of hTERT promoter from psi-Check2.
(1:PCR production 2:DL2000 DNA Marker)

After ligating hTERT and pSB1C3, we transfected the new pasmid being constructed into Ecoli and selected those Ecoli with Chl resistence. Using these Ecoli as templet, we amplified hTERT from pSB1C3,(Fig. 2) which means we had successfly construacted the pSB1C3-hTERT plasmid.

Figure 2. Electrophoretic analysis of PCR product of hTERT promoter from pSB1C3.
(1:DL2000 DNA Marker 2:PCR product)

We then performed single digest(EcoRI) and double digest(EcoRI & PstI) to identify our pSB1C3-hTERT plasmid.(Fig. 3) From the eletrophoretogram, we have two electrophoresis strips at about 454bp and 2070bp, which are exactly the length of hTERT and pSB1C3, respectively in Track 1 and a strip at about 2524bp in Track 2. From this enzyme cutting result, we could make sure the Gene sequence of hTERT succeeded in being constructed into pSB1C3 vector.

Figure 3. Identification of recombinant plasmids pSB1C3-hTERT by one and two restriction enzymes.
[ 1:pSB1C3-hTERT double digest(EcoRI and PstI) 2:pSB1C3-hTERT single digest(EcoRI) 5:DL2000 DNA Marker]

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Design Notes

We designed the following primers and amplified hTERT promoter from the vector psi-Check2:Up: CCGGAATTCGGCACCTCCCTCGGGTTAG Down: TGCACTGCAGACTAGTCGCGTGGGTGGCCG. By incorporating these primers into hTERT promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.

Source

The telomerase reverse transcriptase promoter can be found in human cancer cells. In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, the verification of our system's function was also carried out in Shenzhen Second People's Hospital.

References

[1] Cohen S, Graham M, Lovrecz G, Bache N, Robinson P, Reddel R (2007). "Protein composition of catalytically active human telomerase from immortal cells". Science 315 (5820): 1850–3.