Difference between revisions of "Part:BBa K3286010"
AlexNiederau (Talk | contribs) |
AlexNiederau (Talk | contribs) |
||
Line 49: | Line 49: | ||
</html> | </html> | ||
− | == | + | ==RBS Randomization Library== |
{|class="sortable" style="border:3px solid black; width: 70%" align="center" cellspacing="0" | {|class="sortable" style="border:3px solid black; width: 70%" align="center" cellspacing="0" | ||
! style="background:#AAAAAA; color:black" |Identifier | ! style="background:#AAAAAA; color:black" |Identifier | ||
Line 83: | Line 83: | ||
|align="center"|0.24 | |align="center"|0.24 | ||
|- | |- | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
|} | |} | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
==Note== | ==Note== | ||
Parts <partinfo>J23103</partinfo> and <partinfo>J23112</partinfo> are the same (Rahmi Lale). | Parts <partinfo>J23103</partinfo> and <partinfo>J23112</partinfo> are the same (Rahmi Lale). |
Revision as of 12:48, 21 October 2019
dCas9-AcrIIA4 gene circuit
Usage and Biology
CRISPR interference (CRISPRi) makes use of catalytically inactive variants of Cas9 (dCas9) or Cas12a (dCas12a) proteins to suppress gene expression [1]. Identical to their active counterparts, the co-expression of guide RNAs directs the ribonuclease protein (RNP) to its specific DNA target sequence. However, introduction of mutations in the RuvC1 and HNH nuclease domains of Cas9, and the RuvC I and RuvC II domains of Cas12a, cause the Cas protein to lose endonuclease activity, without impeding the DNA binding [2; 3]. This enables the reversible transcriptional inhibition by tightly DNA-bound dCas proteins, contrary to irreversible cleavage by active Cas9 or Cas12a. One way to reverse the effect of dCas-mediated gene repression is through their natural inhibitors, known as anti-CRISPR (Acr) proteins. Acrs are small, phage-derived proteins blocking the natural CRISPR immune system of bacteria [4]. In most cases, they directly interfere with Cas nucleases, blocking binding or cleavage of the target DNA [5]. Therefore, Acrs may represent a powerful tool for the optimization of CRISPR/Cas-based genome editing approaches or the construction of synthetic circuits [6].
Sequence and Features
The dCas9-AcrIIA4 gene circuit mainly consists out of three parts; the AcrIIA4, the dCas9, and the sgRNA expression module (Part:BBa_K3286009, Part:BBa_K3286008, Part:BBa_K3286003). The acr expression is under the control of the L-rhamnose inducible promoter (Prha) and shares a bi-directional terminator with the dCas9 gene . The dCas9 is being expressed via the tetracyclin promoter regulated via the IPTG-inducible lacI/lac operator (Ptet/lac). The sgRNA (spacer and scaffold) are expressed by the strong constitutive J23119 promoter. The circuit was inserted and tested in the pACYC184 vector with p15a ori and chloramphenicol resistance using High Fidelity Assembly.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 1200
Illegal NheI site found at 5911
Illegal NheI site found at 5934 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 3479
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Functional Characterization
Fluorescence Loss Assay
dCas9 and Acr-dCas9 constructs with three different spacers each where tested in a plate reader experiment for the loss of Gfp fluorescence and restoration of Gfp signal upon acr induction. Assays were conducted in the E. coli DH10B strain carrying a genomically inserted lacUV5_gfp expression cassette. Spacers were designed to either target the –10 element of the lacUV5 promoter or within the first 100 nucleotides of the gfp cds. Figure 1 shows reduction of relative Gfp fluorescence by 90 – 99% for constructs dCas9 spacer 1 – 3. A trend is visible pointing towards spacer 1 being most effective, spacer 2 less, and spacer 3 least. The effectiveness of gfp repression correlates with the distance of the spacers from the lacUV5 promoter region. The results therefore confirm the findings of Larson et al., 2013 [16], who stated that targeting the promoter region is most effective as compared to targeting the 5’ UTR or cds further downstream. For constructs Acr-dCas spacer 1 – 3 the effect of the Acr is clearly visible as 0,2 and 1% L-rhamnose induction results in up to 90% of Gfp signal restoration. However, even if not induced via L-rhamnose, leaky acr expression restores fluorescence to an extend of 50 - 80%. Again, the efficiency of repression decreases from Spacer 1 to Spacer 3. The strong influence of acr promoter leakiness does not meet the requirements of a tight genetic switch mechanism.
RBS Randomization
In order to lower the effect of basal acrIIA4 expression, the ribosomal binding site (RBS) of acrIIA4 was mutagenized. Via PCR, using a primer allowing two different nucleotides at four positions of the RBS core region, 16 (2^4 = 16) different RBSs were created (Figure 2). The resulting PCR product containing the mutagenized RBS was cloned upstream of acrIIA4 into the Acr-dCas spacer 1 vector. After transformation, 43 colonies were picked and screened in a fluorescence loss assay for both low basal acrIIA4 expression when not induced, and high acrIIA4 expression, when induced by L-Rhamnose. The results of ten picked colonies represent the full range of lowest to highest basal AcrIIA4 effect on gfp repression are shown in Figure 2. The randomization of the acrIIA4 RBS resulted in different fluorescence repression levels, reaching from almost 0% the original expression level of 28% (spacer 1). Constructs presented in Figure 2 were sequenced to link the point mutations in the RBS core region to the effect of AcrIIA4 mediated dCas9 repression (figure 3). Sequence identity between various RBSs reduced the extend of the randomized RBS library to seven different sites. Translation initiation rates of RBSs were predicted using the De Novo DNA RBS Library Calculator [9; 10]. Predicted translation initiation rates of acrIIA4 correlate to Acr-mediated Gfp signal restoration to some degree (figure 2&3). Also, the data indicate a correlation between levels of Gfp signal restoration upon 0,2% L-rhamnose induction and Gfp signal repression levels without induction. As RBS C11 showed lowest basal acrIIA4 expression and highest difference in relative Gfp signal between the two treatments (data not shown) it was chosen for follow-up experiments.
==RBS Randomization Library==
Identifier | Sequencea | Measured Strengthb | |
---|---|---|---|
BBa_J23119 | ttgacagctagctcagtcctaggtataatgctagc | n/a | |
BBa_J23100 | ttgacggctagctcagtcctaggtacagtgctagc | 1 | |
BBa_J23101 | tttacagctagctcagtcctaggtattatgctagc | 0.70 | |
BBa_J23102 | ttgacagctagctcagtcctaggtactgtgctagc | 0.86 | |
BBa_J23103 | ctgatagctagctcagtcctagggattatgctagc | 0.01 | |
BBa_J23104 | ttgacagctagctcagtcctaggtattgtgctagc | 0.72 | |
BBa_J23105 | tttacggctagctcagtcctaggtactatgctagc | 0.24 |
Note
Parts BBa_J23103 and BBa_J23112 are the same (Rahmi Lale).