Difference between revisions of "Ribosome Binding Sites/Prokaryotic/Constitutive/Community Collection"

(New page: The Weiss RBS family was contributed to the Registry by Prof. Ron Weiss, Princeton. ==Description== The Weiss RBS family are suitable for general protei...)
 
 
(45 intermediate revisions by 2 users not shown)
Line 1: Line 1:
[[Image:Ron.jpg|thumb|150px|right|The Weiss RBS family was contributed to the Registry by Prof. Ron Weiss, Princeton.]]
+
[[Image:RegistryRBSicon.png|right|75px]]<br>
 
==Description==
 
==Description==
The Weiss RBS family are suitable for general protein expression in ''E. coli'' or other prokaryotes.  The family is known to cover a range of translation initiation rates so by testing a few family members it should be possible to find a translation initiation rate that suits your application.  The family of synthetic RBS were designed by [http://weisswebserver.ee.princeton.edu/users/rweiss/ Ron Weiss].
+
The Community RBS parts are suitable for general protein expression in ''E. coli'' or other prokaryotes.  The family is known to cover a range of translation initiation rates so by testing a few family members it should be possible to find a protein expression level that suits your application.  This collection has developed from the work of several members of the Synthetic Biology community (see Contributors below).  The origin of individual RBS sequences can be found on the corresponding part pages.  Individual family members have been characterized relative to each other or have been derived from other collection members.  See [[Help:Ribosome Binding Sites/Mechanism|here]] for a general description of how Ribosome Binding Sites work.
  
==Obtaining Weiss RBS parts==
+
==Obtaining the Collection==
'''Via ''de novo'' synthesis''': Since the RBS parts are short sequences, they can be easily and cheaply ordered as two single-stranded complementary oligo's and annealed.  See [[Ribosome Binding Sites/Construction|here]] for a tutorial on how to construct short parts via oligo annealing.
+
Sequences for the Community Collection can be found in the table below.  To obtain the physical DNA, we recommend two approaches - <br>
 +
'''Via ''de novo'' synthesis''': Since the RBS parts are short sequences, they can be easily and cheaply ordered as two single-stranded complementary oligos and annealed.  See [[Ribosome Binding Sites/Construction|here]] for a tutorial on how to construct short parts via oligo annealing.
  
'''Via the Registry distribution''': The RBS parts are included in the Registry distribution. ved from these RBS will not match the physical sequence
+
'''Via the Registry distribution''': Many of the RBS parts are included in the Registry DNA distribution.
 
<br style="clear:both" />
 
<br style="clear:both" />
  
==Characterization of the Weiss RBS family==
+
{|class="wikitable" style="border:3px solid black; width: 75%" align="center"  cellspacing="0"
 
+
|+'''Community RBS Collection'''
==Weiss RBS family members==
+
{|class="wikitable" style="border:3px solid black; width: 60%" align="center"  cellspacing="0"
+
 
! style="background:grey; color:black"  |Identifier
 
! style="background:grey; color:black"  |Identifier
 
! style="background:grey; color:black"  |Sequence<sup>a</sup>
 
! style="background:grey; color:black"  |Sequence<sup>a</sup>
! style="background:grey; color:black"  |Strength
+
! colspan="2" style="background:grey; color:black"  |Measured Strength<sup>b</sup>
 +
! colspan="2" style="background:grey; color:black"  |Predicted Strength<sup>c</sup>
 
|-
 
|-
 +
|align="center" style="background:grey; color:black"  |
 +
|align="center" style="background:grey; color:black"  |
 +
|align="center" style="background:grey; color:black"  |Set 1
 +
|align="center" style="background:grey; color:black"  |Set 2
 +
|align="center" style="background:grey; color:black"  |Mean
 +
|align="center" style="background:grey; color:black"  |CV
 +
|-class="sortbottom"
 +
|align="center"|<partinfo>B0029</partinfo>
 +
|align="right"|<font face="Courier" size="+1"><font color="grey">TCTAGAG</font>TTCACACAGGAAACC<font color="grey">TACTAG</font><font color="green">ATG</font></font>
 +
|align="center"|-
 +
|align="center"|0.764
 +
|-class="sortbottom"
 
|align="center"|<partinfo>B0030</partinfo>
 
|align="center"|<partinfo>B0030</partinfo>
 
|align="right"|<font face="Courier" size="+1"><font color="grey">TCTAGAG</font>ATTAAAGAGGAGAAA<font color="grey">TACTAG</font><font color="green">ATG</font></font>
 
|align="right"|<font face="Courier" size="+1"><font color="grey">TCTAGAG</font>ATTAAAGAGGAGAAA<font color="grey">TACTAG</font><font color="green">ATG</font></font>
|align="center"|1
+
|align="center"|0.6
|-
+
|align="center"|-
 +
|-class="sortbottom"
 
|align="center"|<partinfo>B0031</partinfo>
 
|align="center"|<partinfo>B0031</partinfo>
 
| align="right"| <font face="Courier" size="+1"><font color="grey">TCTAGAG</font>TCACACAGGAAACC<font color="grey">TACTAG</font><font color="green">ATG</font></font>
 
| align="right"| <font face="Courier" size="+1"><font color="grey">TCTAGAG</font>TCACACAGGAAACC<font color="grey">TACTAG</font><font color="green">ATG</font></font>
|align="center"|0.12
+
|align="center"|0.07
|-
+
|align="center"|-
 +
|-class="sortbottom"
 
|align="center"|<partinfo>B0032</partinfo>
 
|align="center"|<partinfo>B0032</partinfo>
 
| align="right"| <font face="Courier" size="+1"><font color="grey">TCTAGAG</font>TCACACAGGAAAG<font color="grey">TACTAG</font><font color="green">ATG</font></font>
 
| align="right"| <font face="Courier" size="+1"><font color="grey">TCTAGAG</font>TCACACAGGAAAG<font color="grey">TACTAG</font><font color="green">ATG</font></font>
|align="center"|0.5
+
|align="center"|0.3
|-
+
|align="center"|0.376
 +
|-class="sortbottom"
 
|align="center"|<partinfo>B0033</partinfo>
 
|align="center"|<partinfo>B0033</partinfo>
 
| align="right"| <font face="Courier" size="+1"><font color="grey">TCTAGAG</font>TCACACAGGAC<font color="grey">TACTAG</font><font color="green">ATG</font></font>
 
| align="right"| <font face="Courier" size="+1"><font color="grey">TCTAGAG</font>TCACACAGGAC<font color="grey">TACTAG</font><font color="green">ATG</font></font>
|align="center"|0.012
+
|align="center"|0.01
 +
|align="center"|0.002
 +
|-class="sortbottom"
 +
|align="center"|<partinfo>B0034</partinfo>
 +
| align="right"| <font face="Courier" size="+1"><font color="grey">TCTAGAG</font>AAAGAGGAGAAA<font color="grey">TACTAG</font><font color="green">ATG</font></font>
 +
|align="center"|1
 +
|align="center"|1
 +
|-class="sortbottom"
 +
|align="center"|<partinfo>B0035</partinfo>
 +
| align="right"| <font face="Courier" size="+1"><font color="grey">TCTAGAG</font>ATTAAAGAGGAGAA<font color="grey">TACTAG</font><font color="green">ATG</font></font>
 +
|align="center"|-
 +
|align="center"|1.124
 +
|-class="sortbottom"
 +
|align="center"|<partinfo>B0064</partinfo>
 +
| align="right"| <font face="Courier" size="+1"><font color="grey">TCTAGAG</font>AAAGAGGGGAAA<font color="grey">TACTAG</font><font color="green">ATG</font></font>
 +
|align="center"|0.35
 +
|align="center"|-
 
|}
 
|}
<sup>a</sup>The sequence of individual RBS are shown in black and red.  The grey nucleotides show the bracketing sequence that results from assembling the RBS with an upstream part and a downstream coding sequence.  The start codon of the downstream coding sequence is shown in green.  See the "Obtaining Anderson RBS parts" section above for a description of how the physical DNA sequence of the Anderson RBS parts in the Registry differs slightly from the BioBrick&reg; standard.
+
<sup>a</sup>The sequence of individual RBS are shown in black.  The grey nucleotides show the bracketing sequence that results from assembling the RBS with an upstream part and a downstream coding sequence.  The start codon of the downstream coding sequence is shown in green.<br>
 +
<sup>b</sup>The relative strengths of these RBSs have been measured on (at least) two occasionsThe different datasets are described in the Characterization section below.
 +
==Characterization==
 +
===Set 1===
 +
The data quoted in the table above was obtained by Jason Kelly and Robbie Bryant during the summer of 2004 using a fluorescent reporter.
 +
===Set 2===
 +
The data quoted in the table above was obtained by Jason Kelly and Adam Rubin during 2007/8.  Further detail about these measurements will be added to the registry in the near future.
 +
 
 +
===Other data===
 +
Further data on some of the RBSs (although less quantitative) can be found in the doctoral thesis of [http://www.princeton.edu/~rweiss/papers/rweiss-phd-thesis.pdf Ron Weiss] (p79-80) and the supplementary methods of Gardner et al<cite>Gardner</cite>.  Note that the rank order of strengths as measured by Weiss and Kelly & Bryant differ from those reported by Gardner et al.  This discrepancy is likely due to differences in nucleotide sequence between the Ribosome Binding Site and the start codon due to the cloning strategies used by the different groups.  As is typical for RBS, translation initiation rate can be highly dependent on upstream and downstream sequence for reasons such as RBS occlusion due to mRNA secondary structure or changes in mRNA stability.  For this reason, the strengths of the RBS should be remeasured for different sequence contexts.  Please contribute any data on this RBS family back to the registry.
 +
 
 +
Team William and Mary 2016 also characterized the Community Collection over an IPTG induction curve using a standardized RBS characterization device which standardizes the 5' UTR of the transcript against choice of promoter through the inclusion of the self-cleaving ribozyme RiboJ upstream of the RBS sequence. [http://2016.igem.org/Team:William_and_Mary/RBS See results here.]
 +
 
 +
==References==
 +
<biblio>
 +
#Gardner pmid=10659857
 +
#Weiss Weiss, R. ''Cellular Computation and Communications using Engineered Genetic Regulatory Networks.'' PhD Dissertation, MIT, 2000 [http://www.princeton.edu/~rweiss/papers/rweiss-phd-thesis.pdf (pdf)]
 +
 
 +
</biblio>
 +
==Contributors==
 +
[[Image:Ron.jpg|thumb|150px|left|Several early members of the community collection were based on RBS used by Prof. Ron Weiss, Princeton.]]
 +
[[Image:Jkpic.JPG|thumb|150px|left|Jason Kelly contributed characterization data for some of the RBS in the Community Collection.]]
 +
[[Image:NoPhotoAvailable.jpg|150px|thumb|left|Robbie Bryant contributed characterization data for some of the RBS in the Community Collection.]]
 +
[[Image:AdamRubin.jpg|150px|thumb|left|Adam Rubin contributed characterization data for some of the RBS in the Community Collection.]]
 +
 
 
__NOTOC__
 
__NOTOC__
 
__NOEDITSECTION__
 
__NOEDITSECTION__

Latest revision as of 15:39, 27 October 2016

RegistryRBSicon.png

Description

The Community RBS parts are suitable for general protein expression in E. coli or other prokaryotes. The family is known to cover a range of translation initiation rates so by testing a few family members it should be possible to find a protein expression level that suits your application. This collection has developed from the work of several members of the Synthetic Biology community (see Contributors below). The origin of individual RBS sequences can be found on the corresponding part pages. Individual family members have been characterized relative to each other or have been derived from other collection members. See here for a general description of how Ribosome Binding Sites work.

Obtaining the Collection

Sequences for the Community Collection can be found in the table below. To obtain the physical DNA, we recommend two approaches -
Via de novo synthesis: Since the RBS parts are short sequences, they can be easily and cheaply ordered as two single-stranded complementary oligos and annealed. See here for a tutorial on how to construct short parts via oligo annealing.

Via the Registry distribution: Many of the RBS parts are included in the Registry DNA distribution.

Community RBS Collection
Identifier Sequencea Measured Strengthb Predicted Strengthc
Set 1 Set 2 Mean CV
BBa_B0029 TCTAGAGTTCACACAGGAAACCTACTAGATG - 0.764
BBa_B0030 TCTAGAGATTAAAGAGGAGAAATACTAGATG 0.6 -
BBa_B0031 TCTAGAGTCACACAGGAAACCTACTAGATG 0.07 -
BBa_B0032 TCTAGAGTCACACAGGAAAGTACTAGATG 0.3 0.376
BBa_B0033 TCTAGAGTCACACAGGACTACTAGATG 0.01 0.002
BBa_B0034 TCTAGAGAAAGAGGAGAAATACTAGATG 1 1
BBa_B0035 TCTAGAGATTAAAGAGGAGAATACTAGATG - 1.124
BBa_B0064 TCTAGAGAAAGAGGGGAAATACTAGATG 0.35 -

aThe sequence of individual RBS are shown in black. The grey nucleotides show the bracketing sequence that results from assembling the RBS with an upstream part and a downstream coding sequence. The start codon of the downstream coding sequence is shown in green.
bThe relative strengths of these RBSs have been measured on (at least) two occasions. The different datasets are described in the Characterization section below.

Characterization

Set 1

The data quoted in the table above was obtained by Jason Kelly and Robbie Bryant during the summer of 2004 using a fluorescent reporter.

Set 2

The data quoted in the table above was obtained by Jason Kelly and Adam Rubin during 2007/8. Further detail about these measurements will be added to the registry in the near future.

Other data

Further data on some of the RBSs (although less quantitative) can be found in the doctoral thesis of [http://www.princeton.edu/~rweiss/papers/rweiss-phd-thesis.pdf Ron Weiss] (p79-80) and the supplementary methods of Gardner et alGardner. Note that the rank order of strengths as measured by Weiss and Kelly & Bryant differ from those reported by Gardner et al. This discrepancy is likely due to differences in nucleotide sequence between the Ribosome Binding Site and the start codon due to the cloning strategies used by the different groups. As is typical for RBS, translation initiation rate can be highly dependent on upstream and downstream sequence for reasons such as RBS occlusion due to mRNA secondary structure or changes in mRNA stability. For this reason, the strengths of the RBS should be remeasured for different sequence contexts. Please contribute any data on this RBS family back to the registry.

Team William and Mary 2016 also characterized the Community Collection over an IPTG induction curve using a standardized RBS characterization device which standardizes the 5' UTR of the transcript against choice of promoter through the inclusion of the self-cleaving ribozyme RiboJ upstream of the RBS sequence. [http://2016.igem.org/Team:William_and_Mary/RBS See results here.]

References

<biblio>

  1. Gardner pmid=10659857
  2. Weiss Weiss, R. Cellular Computation and Communications using Engineered Genetic Regulatory Networks. PhD Dissertation, MIT, 2000 [http://www.princeton.edu/~rweiss/papers/rweiss-phd-thesis.pdf (pdf)]

</biblio>

Contributors

Several early members of the community collection were based on RBS used by Prof. Ron Weiss, Princeton.
Jason Kelly contributed characterization data for some of the RBS in the Community Collection.
Robbie Bryant contributed characterization data for some of the RBS in the Community Collection.
Adam Rubin contributed characterization data for some of the RBS in the Community Collection.