Part:BBa_K2333404

Cloning ready protein degradation tag D (medium) with double terminator

This part is designed to facilitate quick, easy and reproducible cloning of protein degradation tag (pdt) D, onto an arbitrary gene, regardless of cloning method. William and Mary iGEM 2017 used pdts as a method to control gene expression speed. Utilizing this part along with results and mathematical modeling from William and Mary should enable the tuning of gene expression speed for any arbitrary protein in a circuit, without having to perform a multistep re-cloning process.See [http://2017.igem.org/Team:William_and_Mary/Results William and Mary's 2017 project] for more details

This part is one of a series of easy cloning pdt parts. Series range is from BBa_K2333401 to BBa_K2333406

Usage and Biology

Protein degradation tag D is of medium strength among the 6 protein degradation tags that William and Mary 2017 characterized, and is associated with the E. Coli orthogonal protease mf-Lon (BBa_K2333011). While any mf-Lon generating part can be used alongside this tag to increase degradation rate/speed of a given protein of interest, the majority of William and Mary 2017's characterization was done using BBa_K2333434, which is a LacI regulated (IPTG inducible) mf-Lon. In cases where LacI cannot be used, the leakier Arabinose inducible mf-Lon BBa_K2333435 can be used instead. (Note, it is recommended that these parts be used on a low copy backbone such as pSB3K3)

This part contains pdt D, a double stop codon and BBa_B0015 (double terminator) in the William and Mary iGEM Universal Nucleotide Sequences (UNS) format. This enables easy cloning with Gibson Assembly, as UNS primers are designed for easy PCRs and high yield Gibson Assembly. See Torella, et. al (2013). On the interior of each UNS are BsaI cut sites, which enables Golden Gate Assembly as an alternative to Gibson Assembly. For groups that want to use restriction enzyme cloning, or a different Golden Gate enzyme/overhang sequence, we recommend that they PCR using the primers below, and add on up to 30 basepairs of overhang.

Since this part contains both a double stop codon and a double terminator, to tag an arbitrary protein all that is required is to append this part without UNS2 to the end of your protein of choice. (Note, that the double stop codons of your protein should be removed, as this will prevent translation of the tag.)

Primers and Cloning Information

As the intent of these parts is to be as easy to clone as possible, we've included some information that might be useful. To clone a pdt onto an arbitrary protein of interest, either digest with BsaI as part of a Golden Gate Assembly reaction or perform overhang PCR with the pdt fwd and <part>B0015</part> reverse, and your overhangs of choice. These can either be restriction cut sites, your overlap sites for Gibson Assembly, or anything else. Remember that you need to remove stop codons from your gene before adding on this tag, and that restriction cut sites should have extra bases added on to allow for effective cutting

The primers below should be useful for cloning purposes. They each are short enough that 20+ basepairs of overhang can be added on, have annealing temperatures in Q5 greater than 60C, and have no significant homo-dimers, hairpins or hetero-dimers. UNS2 F and UNS3 R can be used for sequencing, or amplification to move parts to a new plasmid backbone. Since all of the protein degradation tags have the same first 33 base pairs, the Protein Degradation Primer can be used for any of the pdts in this part series. While these parts should be useful for any group using Gibson Cloning (either in or not in the W&M UNS backbone), they can also be used to add any arbitrary restriction site as well. Using the pdt F and B0015 R primers with restriction site overhangs added on should work robustly, as W&M 2017's used variants of this method to clone most of their tagged reporters. See [http://2017.igem.org/Team:William_and_Mary/Parts here] for a complete list.

Primer Name	Sequence
Protein Degradation Primer, Foward:	GCTGCTAACAAAAACGAAGAAAACAC
UNS2 Primer, Forward:	GCTGGGAGTTCGTAGACG
UNS3 Primer, Reverse:	CGACCTTGATGTTTCCAGTG
End B0015 Primer, Reverse:	tataaacgcagaaaggccca
Double stop + B0015 beginning, Forward:	TAATAAccaggcatcaaataaaacg

Characterization

W&M 2017 characterized pdt D's degradation rate and speed change effects as part of their iGEM project. The graphs below show this data along with the data from the other tags in this series (BBa_K2333401-BBa_K2333406).

Graph 1: Measurements of gene expression were normalized to steady state using aTc inducible mScarlet-I constructs. The data is shown for each construct until steady state is reached (this means at least two consecutive subsequent data points do not increase fluorescence). The geometric mean of 10,000 cells for each of the three biological replicates is shown. The shaded region represents one geometric standard deviation above and below the mean.

Graph 2: Measurements of absolute gene expression using aTC inducible mScarlet-I constructs is displayed. The data is shown for each construct until steady state is reached (this means at least two consecutive subsequent data points do not increase fluorescence). The geometric mean of 10,000 cells for each of three biological replicates is shown. The shaded region represents one geometric standard deviation above and below the mean.

Graph 3: This graph compares calculated t1/2 and degradation rate. Degradation rate was obtained, and t1/2 was defined as the time at which each biological replicate's regression line reached half of steady state. The blue line represents an optical guide for the eye and is not fitted. Speed is scaling with degradation rate and following a predicted trend.

Graph 4: Degradation rates were measured in the above pTet mScarlet-I constructs. Each data point represents the population geometric mean of at least 10,000 cells of a distinct biological replicate. Relative degradation was calculated relative to the geometric mean fluorescence of the untagged control.

Graph 5: This graph compares calculated t1/2 and the pdt construct. The degradation rate was obtained, and t1/2 was defined as the time at which each biological replicate's regression line reached half of steady state. Each data point represents the population geometric mean of at least 10,000 cells of a distinct biological replicate.

Graph 6: Degradation rates were measured in the above pTet sfGFP constructs (BBa_K2333420 to BBa_K2333426). By showing degradation characterization in both the sfGFP reporter and mScarlet-I reporter, W&M 2017 demonstrated modularity.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  INCOMPATIBLE WITH RFC[1000]

  Illegal BsaI site found at 41
  Illegal BsaI.rc site found at 263
  

References

[1] Torella JP, Boehm CR, Lienert F, Chen J-H, Way JC, Silver PA. Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic Acids Research. 2013;42(1):681–689.

[2] Cameron DE, Collins JJ. Tunable protein degradation in bacteria. Nature Biotechnology. 2014;32(12):1276–1281.