Recombination/Bacteriophage P1-derived Cre-lox

< Back to Recombination systems, DNA recombination sites, or Recombinases

Chris Anderson, a professor of bioengineering at UC Berkeley, constructed the lox recombination site BBa_J61046.

Eimad Shotar, a member of the [http://2007.igem.org/Paris 2007 Paris iGEM team], constructed the lox recombination sites BBa_I718016 and BBa_I718017.

The following text is excerpted from Siegel et al. Siegel04.

Bacteriophage P1 uses a site-specific recombination system that is responsible for partitioning newly synthesized genomic copies during replication Abremski, Hoess. This system is composed of a 38-kD phage-encoded Cre recombinase that mediates symmetrical recombination between two 34-bp loxP sites Abremski, which are recreated after recombination. Recombination between two compatible loxP sites will excise or invert the intervening DNA in the case of an intramolecular reaction or transfer suitably flanked loxP DNA in an intermolecular double cross-over recombination event. The Cre/loxP system does not require accessory factors to carry out recombination in vivo or in vitro. Importantly, the Cre/lox system has also been shown to be functional in site-specific recombination in mammalian cell lines Sauer88.

Studies have also identified several hetero-specific loxP sequences that exclusively recombine with themselves, but not with wild-type lox Hoess86, Sauer92, Lee98, Siegel01. For example, the mutant lox66 and lox71 sites make the inversion reaction largely unidirectional, so that the intervening DNA does not flip back to the original orientation.

Recombination sites

*More...*
Name	Description	Sequence	Length
BBa_I718016	lox66	. . . cttggtatagcatacattatacgaacggta	34
BBa_I718017	lox71	. . . gttcgtatacgatacattatacgaagttat	34
BBa_J61046	[Lox] site for recombination	. . . cttcgtataatgtatgctatacgaagttat	34
BBa_K1680005	loxP Site	. . . cttcgtatagcatacattatacgaagttat	34
BBa_K315011	Variant reverse lox N	. . . cttcgtatagtataccttatacgaagttat	34
BBa_K416002	36 Base Pair LoxP	. . . tcgtataatgtatgctatacgaagttatcg	36
BBa_K886000	Fixed lox71	. . . gttcgtatagcatacattatacgaagttat	34

Recombinases

*More...*
Name	Description	Length
BBa_K1680008	Δ1-19 Cre recombinase	972
BBa_K3120003	A human codon-optimized SpCas9	4101
BBa_K112115	a~Cre	1036
BBa_I716212	Cre (GTG start)	1032
BBa_I716213	Cre (TTG start)	1032
BBa_J61047	Cre DNA recombinase	1037
BBa_K1680007	Cre recombinase	1029
BBa_K112122	Cre with stop codon	1032
BBa_K1680017	Cre-Dronpa Fusion	1728
BBa_K1680018	Cre-Dronpa fusion	1746
BBa_K1680019	Cre-dronpa fusion	1764
BBa_K1680020	Cre-dronpa fusion	1782
BBa_K1680021	Dronpa caged Cre with NLS	2433
BBa_K1680022	Dronpa caged Cre with NLS	2451
BBa_K1680023	Dronpa caged Cre with NLS	2469
BBa_K1680024	Dronpa caged Cre with NLS	2487

Composite parts

*More...*
Name	Type	Description	Length	Status
BBa_I718008	Generator	araC-pBad-rbs-cre	2276	In stock
BBa_K082011	Translational_Unit	B0034-J61047	1055	It's complicated
BBa_K132027	Generator	cre induced by iptg	2781	It's complicated
BBa_K132028	Generator	cre terminator	1195	It's complicated
BBa_K5331011	Plasmid	fl4a-nat-loxp	673
BBa_I718007	Translational_Unit	RBS-CRE	1058	In stock
BBa_K886003	Device	Recombination Device composed by Cre-lox71	1079	It's complicated
BBa_K886001	Device	Recombination Device composed by lox71-Cre recombinase	1077	In stock
BBa_K1680025	Reporter	RFP-luciferase Cre reporter	2900	It's complicated

References

Abremski pmid=6319400
Hoess pmid=6230671
Hamilton pmid=6333513
Hoess86 pmid=3457367
Sauer88 pmid=2839833
Sauer92 pmid=1554399
Lee98 pmid=9714735
Sauer98 pmid=9608509
Siegel01 pmid=11576551
Sauer02 pmid=12624421
Siegel04 pmid=15173117

</biblio>