Promoters/Catalog/Prokaryote/Miscellaneous/Positive
The promoters on this page are prokaryotic promoters that are positively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will increase the activity of these promoters. Any prokaryotic promoters other than those from E. coli or B. subtilis are listed here. The equivalent pages for E. coli and B. subtilis are listed here and here. Note that many prokaryotic RNA polymerases recognize similar promoter sequences so many of these promoter sequences will work in other prokaryotes.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_J64001 | psicA from Salmonella | . . . aacgcagtcgttaagttctacaaagtcggt | 143 | 2106 | Not in stock | ||
| BBa_J64750 | SPI-1 TTSS secretion-linked promoter from Salmonella | . . . gtcggtgacagataacaggagtaagtaatg | 167 | 1609 | Not in stock | ||
| BBa_K112149 | PmgtCB Magnesium promoter from Salmonella | . . . tattggctgactataataagcgcaaattca | 280 | 1370 | It's complicated | ||
| BBa_K116201 | ureD promoter from P mirabilis | 1440 | No part sequence | ||||
| BBa_K125100 | nir promoter from Synechocystis sp. PCC6803 | . . . cgaaacgggaaccctatattgatctctact | 88 | 2524 | It's complicated | ||
| BBa_K131017 | p_qrr4 from Vibrio harveyi | . . . aagttggcacgcatcgtgctttatacagat | 275 | 4564 | In stock |