Promoters/Catalog/Prokaryote/Miscellaneous/Constitutive
The promoters on this page are prokaryotic promoters that are constitutive meaning that the activity of these promoters is dependent only on the concentration of the appropriate RNA polymerase and sigma factor. Constitutive prokaryotic promoters other than those from E. coli or B. subtilis are listed here. The equivalent pages for E. coli and B. subtilis are listed here and here. Note that many prokaryotic RNA polymerases recognize similar promoter sequences so many of these promoter sequences will work in other prokaryotes.
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K112706 | Pspv2 from Salmonella | . . . tacaaaataattcccctgcaaacattatca | 474 | 1855 | Not in stock | ||
BBa_K112707 | Pspv from Salmonella | . . . tacaaaataattcccctgcaaacattatcg | 1956 | 1844 | Not in stock |