Promoters/Catalog/Ecoli/Constitutive
All the promoters on this page are E. coli promoters that are constitutive meaning that their activity is dependent on the availability of RNA polymerase holoenzyme, but is not affected by any transcription factors. If you find any promoters on this page that you know to be regulated by a particular transcription factor, please let us know, or re-categorize the part yourself!
Contents
Constitutive E. coli σ70 promoters
This section lists promoters that are recognized by E. coli σ70 RNAP. σ70 is the major E. coli sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I14018 | P(Bla) | . . . gtttatacataggcgagtactctgttatgg | 35 | 1422 | In stock | ||
| BBa_I14033 | P(Cat) | . . . agaggttccaactttcaccataatgaaaca | 38 | 1882 | In stock | ||
| BBa_I14034 | P(Kat) | . . . taaacaactaacggacaattctacctaaca | 45 | 4429 | In stock | ||
| BBa_I732021 | Template for Building Primer Family Member | . . . acatcaagccaaattaaacaggattaacac | 159 | 2643 | Not in stock | ||
| BBa_I742126 | Reverse lambda cI-regulated promoter | . . . gaggtaaaatagtcaacacgcacggtgtta | 49 | 1618 | Not in stock | ||
| BBa_J01006 | Key Promoter absorbs 3 | . . . caggccggaataactccctataatgcgcca | 59 | 1822 | Not in stock | ||
| BBa_J23100 | constitutive promoter family member | . . . ggctagctcagtcctaggtacagtgctagc | 35 | 83466 | In stock | ||
| BBa_J23101 | constitutive promoter family member | . . . agctagctcagtcctaggtattatgctagc | 35 | 53848 | In stock | ||
| BBa_J23102 | constitutive promoter family member | . . . agctagctcagtcctaggtactgtgctagc | 35 | 36949 | In stock | ||
| BBa_J23103 | constitutive promoter family member | . . . agctagctcagtcctagggattatgctagc | 35 | 15860 | In stock | ||
| BBa_J23104 | constitutive promoter family member | . . . agctagctcagtcctaggtattgtgctagc | 35 | 17036 | In stock | ||
| BBa_J23105 | constitutive promoter family member | . . . ggctagctcagtcctaggtactatgctagc | 35 | 42371 | In stock | ||
| BBa_J23106 | constitutive promoter family member | . . . ggctagctcagtcctaggtatagtgctagc | 35 | 63432 | In stock | ||
| BBa_J23107 | constitutive promoter family member | . . . ggctagctcagccctaggtattatgctagc | 35 | 10063 | It's complicated | ||
| BBa_J23108 | constitutive promoter family member | . . . agctagctcagtcctaggtataatgctagc | 35 | 7608 | In stock | ||
| BBa_J23109 | constitutive promoter family member | . . . agctagctcagtcctagggactgtgctagc | 35 | 12460 | In stock | ||
| BBa_J23110 | constitutive promoter family member | . . . ggctagctcagtcctaggtacaatgctagc | 35 | 31909 | In stock | ||
| BBa_J23111 | constitutive promoter family member | . . . ggctagctcagtcctaggtatagtgctagc | 35 | 10020 | In stock | ||
| BBa_J23112 | constitutive promoter family member | . . . agctagctcagtcctagggattatgctagc | 35 | 20261 | In stock | ||
| BBa_J23113 | constitutive promoter family member | . . . ggctagctcagtcctagggattatgctagc | 35 | 12165 | In stock | ||
| BBa_J23114 | constitutive promoter family member | . . . ggctagctcagtcctaggtacaatgctagc | 35 | 39200 | In stock | ||
| BBa_J23115 | constitutive promoter family member | . . . agctagctcagcccttggtacaatgctagc | 35 | 13866 | In stock | ||
| BBa_J23116 | constitutive promoter family member | . . . agctagctcagtcctagggactatgctagc | 35 | 25084 | In stock | ||
| BBa_J23117 | constitutive promoter family member | . . . agctagctcagtcctagggattgtgctagc | 35 | 12453 | In stock | ||
| BBa_J23118 | constitutive promoter family member | . . . ggctagctcagtcctaggtattgtgctagc | 35 | 38811 | In stock | ||
| BBa_J23119 | constitutive promoter family member | . . . agctagctcagtcctaggtataatgctagc | 35 | 31843 | In stock | ||
| BBa_J23150 | 1bp mutant from J23107 | . . . ggctagctcagtcctaggtattatgctagc | 35 | 1155 | In stock | ||
| BBa_J23151 | 1bp mutant from J23114 | . . . ggctagctcagtcctaggtacaatgctagc | 35 | 1154 | Not in stock | ||
| BBa_J44002 | pBAD reverse | . . . aaagtgtgacgccgtgcaaataatcaatgt | 130 | 1341 | In stock | ||
| BBa_J48104 | NikR promoter, a protein of the ribbon helix-helix family of trancription factors that repress expre | . . . gacgaatacttaaaatcgtcatacttattt | 40 | 1228 | Not in stock | ||
| BBa_J54200 | lacq_Promoter | . . . aaacctttcgcggtatggcatgatagcgcc | 50 | 1204 | Not in stock | ||
| BBa_J56015 | lacIQ - promoter sequence | . . . tgatagcgcccggaagagagtcaattcagg | 57 | 1223 | Not in stock | ||
| BBa_J64951 | E. Coli CreABCD phosphate sensing operon promoter | . . . ttatttaccgtgacgaactaattgctcgtg | 81 | 1229 | Not in stock | ||
| BBa_K088007 | GlnRS promoter | . . . catacgccgttatacgttgtttacgctttg | 38 | 1306 | It's complicated | ||
| BBa_K119000 | Constitutive weak promoter of lacZ | . . . ttatgcttccggctcgtatgttgtgtggac | 38 | 1269 | Not in stock | ||
| BBa_K119001 | Mutated LacZ promoter | . . . ttatgcttccggctcgtatggtgtgtggac | 38 | 1322 | Not in stock | ||
| BBa_K1330002 | Constitutive promoter (J23105) | . . . ggctagctcagtcctaggtactatgctagc | 35 | 2011 | In stock | ||
| BBa_K137029 | constitutive promoter with (TA)10 between -10 and -35 elements | . . . atatatatatatatataatggaagcgtttt | 39 | 1496 | It's complicated | ||
| BBa_K137030 | constitutive promoter with (TA)9 between -10 and -35 elements | . . . atatatatatatatataatggaagcgtttt | 37 | 1499 | It's complicated | ||
| BBa_K137031 | constitutive promoter with (C)10 between -10 and -35 elements | . . . ccccgaaagcttaagaatataattgtaagc | 62 | 1499 | It's complicated | ||
| BBa_K137032 | constitutive promoter with (C)12 between -10 and -35 elements | . . . ccccgaaagcttaagaatataattgtaagc | 64 | 1494 | It's complicated | ||
| BBa_K137085 | optimized (TA) repeat constitutive promoter with 13 bp between -10 and -35 elements | . . . tgacaatatatatatatatataatgctagc | 31 | 1251 | Not in stock | ||
| BBa_K137086 | optimized (TA) repeat constitutive promoter with 15 bp between -10 and -35 elements | . . . acaatatatatatatatatataatgctagc | 33 | 1251 | Not in stock | ||
| BBa_K137087 | optimized (TA) repeat constitutive promoter with 17 bp between -10 and -35 elements | . . . aatatatatatatatatatataatgctagc | 35 | 1251 | Not in stock | ||
| BBa_K137088 | optimized (TA) repeat constitutive promoter with 19 bp between -10 and -35 elements | . . . tatatatatatatatatatataatgctagc | 37 | 1251 | Not in stock | ||
| BBa_K137089 | optimized (TA) repeat constitutive promoter with 21 bp between -10 and -35 elements | . . . tatatatatatatatatatataatgctagc | 39 | 1251 | Not in stock | ||
| BBa_K137090 | optimized (A) repeat constitutive promoter with 17 bp between -10 and -35 elements | . . . aaaaaaaaaaaaaaaaaatataatgctagc | 35 | 1250 | Not in stock | ||
| BBa_K137091 | optimized (A) repeat constitutive promoter with 18 bp between -10 and -35 elements | . . . aaaaaaaaaaaaaaaaaatataatgctagc | 36 | 1250 | Not in stock | ||
| BBa_K1585100 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2212 | Not in stock | ||
| BBa_K1585101 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2173 | Not in stock | ||
| BBa_K1585102 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2175 | Not in stock | ||
| BBa_K1585103 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2172 | Not in stock | ||
| BBa_K1585104 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2175 | Not in stock | ||
| BBa_K1585105 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2174 | Not in stock | ||
| BBa_K1585106 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2174 | Not in stock | ||
| BBa_K1585110 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2130 | Not in stock | ||
| BBa_K1585113 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2175 | Not in stock | ||
| BBa_K1585115 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2176 | Not in stock | ||
| BBa_K1585116 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2174 | Not in stock | ||
| BBa_K1585117 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2175 | Not in stock | ||
| BBa_K1585118 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2174 | Not in stock | ||
| BBa_K1585119 | Anderson Promoter with lacI binding site | . . . ggaattgtgagcggataacaatttcacaca | 78 | 2175 | Not in stock | ||
| BBa_K1824896 | J23100 + RBS | . . . gattaaagaggagaaatactagagtactag | 88 | 1390 | It's complicated | ||
| BBa_K2486171 | A reverse complement version of BBa_J23114 | . . . cattgtacctaggactgagctagccataaa | 35 | 1639 | Not in stock | ||
| BBa_K256002 | J23101:GFP | . . . caccttcgggtgggcctttctgcgtttata | 918 | 1176 | In stock | ||
| BBa_K256018 | J23119:IFP | . . . caccttcgggtgggcctttctgcgtttata | 1167 | 1372 | It's complicated | ||
| BBa_K256020 | J23119:HO1 | . . . caccttcgggtgggcctttctgcgtttata | 949 | 1886 | It's complicated | ||
| BBa_K256033 | Infrared signal reporter (J23119:IFP:J23119:HO1) | . . . caccttcgggtgggcctttctgcgtttata | 2124 | 10501 | It's complicated | ||
| BBa_K292000 | Double terminator + constitutive promoter | . . . ggctagctcagtcctaggtacagtgctagc | 138 | 1836 | It's complicated | ||
| BBa_K292001 | Double terminator + Constitutive promoter + Strong RBS | . . . tgctagctactagagattaaagaggagaaa | 161 | 2027 | It's complicated | ||
| BBa_K418000 | IPTG inducible Lac promoter cassette | . . . ttgtgagcggataacaagatactgagcaca | 1416 | 1151 | Not in stock | ||
| BBa_K418002 | IPTG inducible Lac promoter cassette | . . . ttgtgagcggataacaagatactgagcaca | 1414 | 1169 | It's complicated | ||
| BBa_K418003 | IPTG inducible Lac promoter cassette | . . . ttgtgagcggataacaagatactgagcaca | 1416 | 1169 | It's complicated | ||
| BBa_K823004 | Anderson promoter J23100 | . . . ggctagctcagtcctaggtacagtgctagc | 35 | 7740 | In stock | ||
| BBa_K823005 | Anderson promoter J23101 | . . . agctagctcagtcctaggtattatgctagc | 35 | 7970 | In stock | ||
| BBa_K823006 | Anderson promoter J23102 | . . . agctagctcagtcctaggtactgtgctagc | 35 | 7716 | In stock | ||
| BBa_K823007 | Anderson promoter J23103 | . . . agctagctcagtcctagggattatgctagc | 35 | 7716 | In stock | ||
| BBa_K823008 | Anderson promoter J23106 | . . . ggctagctcagtcctaggtatagtgctagc | 35 | 7716 | In stock | ||
| BBa_K823010 | Anderson promoter J23113 | . . . ggctagctcagtcctagggattatgctagc | 35 | 7716 | In stock | ||
| BBa_K823011 | Anderson promoter J23114 | . . . ggctagctcagtcctaggtacaatgctagc | 35 | 7716 | In stock | ||
| BBa_K823013 | Anderson promoter J23117 | . . . agctagctcagtcctagggattgtgctagc | 35 | 7716 | In stock | ||
| BBa_K823014 | Anderson promoter J23118 | . . . ggctagctcagtcctaggtattgtgctagc | 35 | 7715 | In stock | ||
| BBa_M13101 | M13K07 gene I promoter | . . . cctgtttttatgttattctctctgtaaagg | 47 | 1492 | Not in stock | ||
| BBa_M13102 | M13K07 gene II promoter | . . . aaatatttgcttatacaatcttcctgtttt | 48 | 1493 | Not in stock | ||
| BBa_M13103 | M13K07 gene III promoter | . . . gctgataaaccgatacaattaaaggctcct | 48 | 1495 | Not in stock | ||
| BBa_M13104 | M13K07 gene IV promoter | . . . ctcttctcagcgtcttaatctaagctatcg | 49 | 1494 | Not in stock | ||
| BBa_M13105 | M13K07 gene V promoter | . . . atgagccagttcttaaaatcgcataaggta | 50 | 1491 | Not in stock | ||
| BBa_M13106 | M13K07 gene VI promoter | . . . ctattgattgtgacaaaataaacttattcc | 49 | 1493 | Not in stock | ||
| BBa_M13108 | M13K07 gene VIII promoter | . . . gtttcgcgcttggtataatcgctgggggtc | 47 | 1496 | Not in stock | ||
| BBa_M13110 | M13110 | . . . ctttgcttctgactataatagtcagggtaa | 48 | 1491 | Not in stock | ||
| BBa_M31519 | Modified promoter sequence of g3. | . . . aaaccgatacaattaaaggctcctgctagc | 60 | 1506 | Not in stock | ||
| BBa_R1074 | Constitutive Promoter I | . . . caccacactgatagtgctagtgtagatcac | 74 | 1253 | Not in stock | ||
| BBa_R1075 | Constitutive Promoter II | . . . gccggaataactccctataatgcgccacca | 49 | 1503 | Not in stock | ||
| BBa_S03331 | --Specify Parts List-- | ttgacaagcttttcctcagctccgtaaact | 30 | 1586 | Not in stock |
Constitutive E. coli σS promoters
This section lists promoters that are recognized by E. coli σS RNAP. σS is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation. Since σS promoters have the same consensus promoter sequence as σ70 promoters, you may find these promoters will be weakly expressed by σ70 RNAP.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_J45992 | Full-length stationary phase osmY promoter | . . . ggtttcaaaattgtgatctatatttaacaa | 199 | 10676 | In stock | ||
| BBa_J45993 | Minimal stationary phase osmY promoter | . . . ggtttcaaaattgtgatctatatttaacaa | 57 | 3463 | Not in stock |
Constitutive E. coli σ32 promoters
This section lists promoters that are recognized by E. coli σ32 RNAP. σ32 is the major heat shock sigma factor in E. coli. Use these promoters when you want high promoter activity during heat shock. These promoters are also active under several different shock responses.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_J45504 | htpG Heat Shock Promoter | . . . tctattccaataaagaaatcttcctgcgtg | 405 | 1497 | Not in stock | ||
| BBa_K1895002 | dnaK Promoter | . . . gaccgaatatatagtggaaacgtttagatg | 182 | 2645 | Not in stock | ||
| BBa_K1895003 | htpG Promoter | . . . ccacatcctgtttttaaccttaaaatggca | 287 | 1890 | Not in stock |
Constitutive E. coli σ54 promoters
This section lists promoters that are recognized by E. coli σ54 RNAP. σ54 is a minor E. coli sigma factor that is most highly expressed during nitrogen-limitation. Use these promoters if you want promoter activity to depend on ammonia or nitrogen levels. Alternatively, since this is a minor sigma factor that recognizes promoters with a very different sequence to σ70 promoters, this sigma factor could be repurposed to be be expressed and active during some user-chosen set of environmental conditions, essentially producing a user controllable RNAP.
There are no parts for this table