1 Registry Star
Part:BBa_R0080
Promoter (AraC regulated)
AraC operator, truncated to include araO1, araI1, araI2, c-amp1, and c-amp2 sites. This operator should *activate* transcription in the presence of AraC or the simple sugar [http://openwetware.org/wiki/Arabinose arabinose]
b/c the operator lacks the araO2 site, there should not be araC-mediated repression.
Usage and Biology
araC binding region from E.coli
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 103
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Functional Parameters: Austin_UTexas
Burden Imposed by this Part:
Burden is the percent reduction in the growth rate of E. coli cells transformed with a plasmid containing this BioBrick (± values are 95% confidence limits). This BioBrick did not exhibit a burden that was significantly greater than zero (i.e., it appears to have little to no impact on growth). Therefore, users can depend on this part to remain stable for many bacterial cell divisions and in large culture volumes. Refer to any one of the BBa_K3174002 - BBa_K3174007 pages for more information on the methods, an explanation of the sources of burden, and other conclusions from a large-scale measurement project conducted by the 2019 Austin_UTexas team.
This functional parameter was added by the 2020 Austin_UTexas team.
2020 AHUT-ZJU-China’s Characterization
<!DOCTYPE html>
The Optimal Arabinose Concentration and Temperature for the Expression of Protein in E.coli BL21 (DE3) with the Promoter BBa_R0080 and pSB1C3 and the Relation between the Strength of BBa_R0080 and Arabinose Concentration at the Transcription Level.
Overview
In 2020, AHUT-ZJU-China constructed an EGFP expression vector (with pSB1C3 as the plasmid skeleton) in which the expression of EGFP was controlled by the promoter BBa_R0080 and transformed it into E.coli BL21 (DE3) which is commonly used to express protein. Then, by measuring the EGFP fluorescence, we investigate the optimal arabinose concentration and temperature for the expression of protein in E.coli BL21 (DE3) using the BBa_R0080 in pSB1C3.
Results
Our part vectors contained EGFP were successfully constructed and sequence results were correct. Then we picked the positive clone for further experiment. When the E.coli BL21(DE3) was cultured at the OD600 between 0.6 to 0.8, we added arabinose in different concentration and cultured the E.coli in different temperature. Absolute fluorescence and OD600 assessed by fluorescence microplate reader was shown below.
Fig1. Fluorescence of EGFP under different treatment condition. Fig 1(A) (B) represents the treatment at 25℃, 30℃ respectively. The horizontal axis shows the different concentrations of Arabinose, the vertical axis shows the green fluorescence per OD600 (excitation wavelength: 485 nm; detection wavelength: 528 nm), and segments and data points of different colors show the different culture temperature. Error bar indicates the standard error of replicates.
From Fig1 we can learn that compare with 25℃, BBa_R0080 has as higher expression level under 30℃. And the optimum concentration under 30℃ is 0.1% of arabinose.
Protocol
Fluorescence Characterization1. Linearize pSB1c3 plasmid by PCR.
(F: TACTAGTAGCGGCCGCTGCAG,R: CTCTAGAAGCGGCCGCGAATTC)
2. Obtain the sequence of BBa_R0080 from 2019 DNA Distribution Kit by PCR.
(F: GAATTCGCGGCCGCTTCTAGAG, R: CTGCAGCGGCCGCTACTAGTA)
3. Obtain the RBS+EGFP sequence and part sequence by PCR. Plasmid contained EGFP sequence was kindly donated by Associated Prof. Wentao Jin, sequence was identical to UniProtKB - A0A2V2QJP9
(F:AAAGAGGAGAAATACTAGATGAGCAAGGGC, R:TTACTTGTACAGCTCGTCCATG)
4. Use homologous recombination to construct the BBa_R0080-EGFP pasmid
5. Transform the recombination plasmids into E.coli DH5α, then pick the positive clones and sequence.
6. After recombinational sequence results were comfirmed, transform the plasmids into E.coli BL21(DE3).
7. Coated the transformed BL21 onto the plate and added 1mM IPTG.
8. Incubated at 37℃ overnight and observed colony color under the blue light to see if the EGFP is expressed
9. Picked greener single colonies, add them into 1mL Lb, incubate at 37℃ in a shaker for 6-8h till the OD600 reach 0.6-0.8.
10. Add 50μl germ solution from last step into 5mL Lb, add IPTG in different concentration and induce for 5h at 25℃, 30℃.
11. Measure the fluorescence (excitation wavelength: 485 nm; detection wavelength: 528 nm) and OD600.
//direction/forward
//promoter
//regulation/positive
//rnap/prokaryote/ecoli/sigma70
| biology | |
| control | araC |
| direction | Forward |
| negative_regulators | |
| o_h | |
| o_l | |
| positive_regulators | 1 |