Part:BBa_K5237998
fgRNA Entryvector MbCas12a-SpCas9
This part integrates the crRNA of MbCas12a (BBa_K5237206) and the sgRNA of SpCas9 (BBa_K5237209) into a single fusion guide RNA (fgRNA). The fgRNA is functional meaning that the MbCas12a (BBa_K5237998), SpCas9 (BBa_K5237002) and the Cas-Staple (BBa_K5237003) can utilize the fgRNA to target two loci simultaneously. The fgRNA also works with the catalyitcally inactive versions. We could show editing with the active version and induced proximity of to loci with the inactive version.
Contents
The 3D organization of the genome plays a crucial role in regulating gene expression in eukaryotic cells,
impacting cellular behavior, evolution, and disease. Beyond the linear DNA sequence, the spatial arrangement of
chromatin, influenced by DNA-DNA interactions, shapes pathways of gene regulation. However, the tools to precisely
manipulate this genomic architecture remain limited, rendering it challenging to explore the full potential of the
3D genome in synthetic biology. We - iGEM Team Heidelberg 2024 - have developed PICasSO, a powerful molecular
toolbox based on various DNA-binding proteins to address this issue.
The PICasSO part collection offers a comprehensive, modular platform for precise manipulation and re-programming of DNA-DNA interactions using protein staples in living cells, enabling researchers to recreate natural 3D genomic interactions, such as enhancer hijacking, or to design entirely new spatial architectures for gene regulation. Beyond its versatility, PICasSO includes robust assay systems to support the engineering, optimization, and testing of new staples, ensuring functionality in vitro and in vivo. We took special care to include parts crucial for testing every step of the cycle (design, build, test, learn) when engineering new parts
At its heart, the PICasSO part collection consists of three categories.
(i) Our DNA-binding
proteins
include our
finalized enhancer hijacking Cas staple as well as half staples that can be used by scientists to compose entirely
new Cas staples in the future. We also include our simple staples that serve as controls for successful stapling
and can be further engineered to create alternative, simpler and more compact staples.
(ii) As functional elements, we list additional parts that enhance the functionality of our Cas and
Basic staples. These
consist of
protease-cleavable peptide linkers and inteins that allow condition-specific, dynamic stapling in vivo.
Besides staple functionality, we also include the parts to enable the efficient delivery of PICasSO's constructs
with our
interkingdom conjugation system.
(iii) As the final component of our collection, we provide parts that support the use of our custom
readout
systems. These include components of our established FRET-based proximity assay system, enabling users to
confirm
accurate stapling. Additionally, we offer a complementary, application-oriented testing system for functional
readout via a luciferase reporter, which allows for straightforward experimental simulation of enhancer hijacking.
The following table gives a complete overview of all parts in our PICasSO toolbox. The highlighted parts showed
exceptional performance as described on our iGEM wiki and can serve as a reference. The other parts in the
collection are versatile building blocks designed to provide future iGEMers with the flexibility to engineer their
own custom Cas staples, enabling further optimization and innovation.
Our part collection includes:
| DNA-binding proteins: The building blocks for engineering of custom staples for DNA-DNA interactions with a modular system ensuring easy assembly. | ||
| BBa_K5237998 | fgRNA Entryvector MbCas12a-SpCas9 | Entryvector for simple fgRNA cloning via SapI |
| BBa_K5237001 | Staple subunit: dMbCas12a-Nucleoplasmin NLS | Staple subunit that can be combined to form a functional staple, for example with fgRNA and dCas9 |
| BBa_K5237002 | Staple subunit: SV40 NLS-dSpCas9-SV40 NLS | Staple subunit that can be combined to form a functional staple, for example with our fgRNA or dCas12a |
| BBa_K5237003 | Cas-Staple: SV40 NLS-dMbCas12a-dSpCas9-Nucleoplasmin NLS | Functional Cas staple that can be combined with sgRNA or fgRNA to bring two DNA strands in close proximity |
| BBa_K5237004 | Staple subunit: Oct1-DBD | Staple subunit that can be combined to form a functional staple, for example with TetR. Can also be combined with a fluorescent protein as part of the FRET proximity assay |
| BBa_K5237005 | Staple subunit: TetR | Staple subunit that can be combined to form a functional staple, for example with Oct1. Can also be combined with a fluorescent protein as part of the FRET proximity assay |
| BBa_K5237006 | Simple taple: TetR-Oct1 | Functional staple that can be used to bring two DNA strands in close proximity |
| BBa_K5237007 | Staple subunit: GCN4 | Staple subunit that can be combined to form a functional staple, for example with rGCN4 |
| BBa_K5237008 | Staple subunit: rGCN4 | Staple subunit that can be combined to form a functional staple, for example with rGCN4 |
| BBa_K5237009 | Mini staple: bGCN4 | Assembled staple with minimal size that can be further engineered | Functional elements: Protease cleavable peptide linkers and inteins are used to control and modify staples for further optimization for custom applications. |
| BBa_K5237010 | Cathepsin B-Cleavable Linker (GFLG) | Cathepsin B cleavable peptide linker, that can be used to combine two staple subunits ,to make responsive staples |
| BBa_K5237011 | Cathepsin B Expression Cassette | Cathepsin B which can be selectively express to cut the cleavable linker |
| BBa_K5237012 | Caged NpuN Intein | Undergoes protein transsplicing after protease activation, can be used to create functionalized staple units |
| BBa_K5237013 | Caged NpuC Intein | Undergoes protein transsplicing after protease activation, can be used to create functionalized staple units |
| BBa_K5237014 | fgRNA processing casette | Processing casette to produce multiple fgRNAs from one transcript, can be used for multiplexing |
| BBa_K5237015 | Intimin anti-EGFR Nanobody | Interkindom conjugation between bacteria and mammalian cells, as alternative delivery tool for large constructs | Readout Systems: FRET and enhancer recruitment to measure proximity of stapled DNA in bacterial and mammalian living cells enabling swift testing and easy development for new systems. |
| BBa_K5237016 | FRET-Donor: mNeonGreen-Oct1 | Donor part for the FRET assay binding the Oct1 binding cassette. Can be used to visualize DNA-DNA proximity |
| BBa_K5237017 | FRET-Acceptor: TetR-mScarlet-I | Acceptor part for the FRET assay binding the TetR binding cassette. Can be used to visualize DNA-DNA proximity |
| BBa_K5237018 | Oct1 Binding Casette | DNA sequence containing 12 Oct1 binding motifs, can be used for different assays such as the FRET proximity assay |
| BBa_K5237019 | TetR Binding Cassette | DNA sequence containing 12 Oct1 binding motifs, can be used for different assays such as the FRET proximity assay | BBa_K5237020 | Cathepsin B-Cleavable Trans-Activator: NLS-Gal4-GFLG-VP64 | Readout system that responds to protease activity. It was used to test Cathepsin-B cleavable linker. |
| BBa_K5237021 | NLS-Gal4-VP64 | Trans-activating enhancer, that can be used to simulate enhancer hijacking. | BBa_K5237022 | mCherry Expression Cassette: UAS, minimal Promotor, mCherry | Readout system for enhancer binding. It was used to test Cathepsin-B cleavable linker. |
| BBa_K5237023 | Oct1 - 5x UAS binding casette | Oct1 and UAS binding cassette, that was used for the simulated enhancer hijacking assay. |
| BBa_K5237024 | TRE-minimal promoter- firefly luciferase | Contains Firefly luciferase controlled by a minimal promoter. It was used as a luminescence readout for simulated enhancer hijacking. |
1. Sequence overview
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 331
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 563
Illegal SapI site found at 654
Illegal SapI.rc site found at 272
2. Usage and Biology
2.1 Discovery and Mechanism of CRISPR/Cas9
In 2012, Jinek et al. discovered the use of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas system to induce double-strand breaks in DNA. Since then, the system has been well established as a tool for genome editing. The CRISPR/Cas system, which originates from the bacterial immune system, is constituted by a ribonucleoprotein complex. For class 1 CRISPR systems, the RNA is complexed by multiple Cas proteins, whereas class 2 systems consist of a singular protein and RNA. The class 2 type II system describes all ribonucleoprotein complexes with Cas9 (Pacesa et al., 2024). They include a CRISPR RNA (crRNA), which specifies the target with a 20 nucleotide (nt) spacer sequence, and a transactivating CRISPR RNA (tracrRNA), which induces the processing by the Cas protein (Jinek et al., 2012) (Fig. 2 A). Furthermore, a specific three nucleotide sequence (NGG) on the 3' end in the targeted DNA is needed for binding and cleavage. This is referred to as the protospacer adjacent motif (PAM) (Sternberg et al., 2014). The most commonly used Cas9 protein is SpCas9 or SpyCas9, which originates from Streptococcus pyogenes (Pacesa et al., 2024).
A significant enhancement of this system was the introduction of single guide RNA (sgRNA)s, which combine the functions of a tracrRNA and crRNA (Mali et al., 2013). Moreover, Cong (2013) established precise targeting of human endogenous loci by designing the 20 nt spacer sequence accordingly.
2.2 Differences between Cas9 and Cas12a
Over the following years, further CRISPR/Cas systems have been discovered, including the Cpf1 system, which has been classified as Cas12a since then (Zetsche et al., 2015). Cas12a forms a class 2 type V system with its RNA, that in comparison to the type II systems, only requires a crRNA for targeting and activation. Cas12a is capable of processing the precursor crRNA into crRNA independently, whereas Cas9 requires the RNase III enzyme and tracrRNA for this process (Paul and Montoya, 2020). This crRNA is often also referred to as a guide RNA (gRNA). However, the stem loop that is formed when binding the Cas protein is structurally distinct to the Cas9 gRNA and positioned on the 5' side of the crRNA (Fig. 2 B). Similarly, the PAM (TTTV) is also on the 5' side (Pacesa et al., 2024). Cas9 possesses RuvC and HNH domains that are catalytically active, each of which cleaves one of the DNA strands at the same site, resulting in the formation of blunt end cuts (Nishimasu et al., 2014). Cas12a possesses one RuvC-like domain that creates staggered cuts with overhangs that are about 5nt long (Paul and Montoya, 2020).
2.3 Dead Cas Proteins and their Application
Specific mutations of these domains result in catalytic inactivity and therefore allow for the creation of nickases that only cut one of the DNA strands, or completely inactive Cas proteins (Koonin et al., 2023) (Kleinstiver et al., 2019). These are referred to as dead Cas proteins or dCas9 and dCas12a. These Cas proteins can be used to activate (CRISPRa) or inhibit (CRISPRi) the expression of genes by fusing them to effector domains and targeting the respective gene with the spacer sequence (Kampmann, 2017). A common approach for CRISPRa involves fusing Cas9 with the transcriptional activator VP64 (Kampmann, 2017).
2.4 fgRNA and CHyMErA System
Kweon et al. (2017) further expanded the ways in which the CRISPR/Cas system could be used by introducing the concept of fusion guide RNA (fgRNA)s. By fusing the 3' end of a Cas12a gRNA to the 5' end of a Cas9 gRNA, the newly created fgRNA could be used by both proteins independently for either multiplex genome editing or transcriptional regulation and genome editing in parallel (Fig. 3). Similarly, this is also possible using the Cas Hybrid for Multiplexed Editing and screening Applications (CHyMErA) system (Gonatopoulos-Pournatzis et al., 2020). In this instance, the gRNAs of Cas12a and Cas9 are connected in the opposite direction (3' Cas9 gRNA to 5' Cas12a gRNA), allowing for Cas12a to process the RNA into individual units (Fig. 3). Amongst other things, this allows for the analysis of the interaction between different genes by targeting them simultaneously with the two distinct spacers (Aregger et al., 2021) (Fig. 3).
3. Assembly and part evolution
Building on insights of our fusion Cas engineering cycle and findings from Kweon (2017), fgRNAs were designed by
combining the sgRNA from SpCas9 with the crRNA from MbCas12a, specifically the 3'-end of the MbCas12a gRNA was
fused to the 5'-end of the SpCas9 gRNA. Via this approach the two spacer sequences are fused directly, ensuring a
minimal distance between the two DNA strands.This also facilitates efficient cloning of different spacer
sequences. Linking the crRNA and sgRNA comes with the advantage of easily multiplexing the system, while still
guaranteeing that specific pairs of genomic loci are connected. The entry vector includes a U6 promoter, the
MbCas12a scaffold, a bacterial promoter driving ccdB expression, and the SpCas9 scaffold. Successful spacer
integration leads to the removal of the ccdB gene, allowing bacterial growth to be used as an indicator for
cloning success.
An existing vector containing the U6 promoter and the MbCas12a scaffold was selected as the basis
for entry vector cloning. The vector and a ccdB-SpCas9 scaffold construct were PCR amplified and fitting overhangs
for SapI were introduced. Golden Gate assembly (GGA) with Esp3I was used to create the final plasmid. The
transformation was carried out in the ccdB-resistant XL1 BlueE. Coli strain.
The first goal after assembly was to prove the editing activity of both proteins using fgRNA. The genes VEGFA and FANCF were selected as targets for Cas12a and Cas9, each target was tested with each Cas protein. Editing efficiency will be analyzed with the T7 Endonuclease I (T7EI) assay. Controls will include crRNAs and sgRNAs as positive controls, and non-targeting guides as negative controls. Desired spacer sequences can be ordered as oligos, annealed, and cloned in via GGA utilizing SapI.
| Table 1: A list of all the different spacers we cloned and tested within the fgRNA | |
| VEGFA | ctaggaatattgaagggggc |
| FANCF | ggcggggtccagttccggga |
| CCR5 | tgacatcaattattatacat |
| TetO (BBa_K5237019) | tctctatcactgatagggag |
| Oct1-B (BBa_K5237018) | atgcaaatactgcactagtg |
We constructed a second entry vector incorporating an AsCas12a scaffold (5' taatttctactcttgtagat 3') instead of MbCas12a. The sequence of the AsCas12a scaffold, was the only modification in the composite part. This vector was tested on the loci VEGFA and FANCF to assess its functionality.
4. Results
4.1 Editing endogenous loci with fgRNAs
To prove that our fusion gRNAs still result in active ribonucleoproteins, a series of different fgRNAs were
created, each carrying spacers specific to the VEGFA and FANCF genes.HEK293-T cells were transfected with the Cas
protein and gRNA constructs. The editing rate was tested 72h after transfection via a T7 endonuclease I assay.
AsCas12a and SpCas9 were used. The AsCas12a spacer targets VEGFA, while the SpCas9 spacer targets FANCF. The
samples included standard single gRNAs with the corresponding Cas protein, the fgRNA with only one of the two Cas
proteins and the fgRNA with both Cas proteins simultaneously (Fig. 5). The sgRNAs allowed for
the highest editing rates for both genes (45% for VEGFA and 15% for FANCF), while the editing rates for FANCF were
consistently lower in all experiments. Importantly, targeting FANCF with fgRNAs resulted in noticeable editing of
about 10%, with just the SpCas9 and both Cas proteins in the sample. For VEGFA, the AsCas12a only sample resulted
in approximately 20% editing rate in combination with the fgRNA, while adding both Cas proteins led to
approximately 40%. These initial results confirmed our engineering approach proving efficient genome editing with
fgRNAs.
4.2 Fusion Guide RNAs Allow for Editing Rates With Variant Cas Orthologs
To further evaluate the capabilities of the fgRNAs, we tested them in combination with different Cas12a orthologs. After some initial testing, we decided on using MbCas12a together with SpCas9, because we found AsCas12a to be less active in a dual luciferase assay when co-transfected with SpCas9 compared to MbCas12a (Fig. 6). Between these two co-transfections the SpCas9 editing has not been significantly different.
Additionally, to test if the differences in editing rates from the preliminary assay resulted from the targeted
loci or the different Cas orthologs, the spacers were tested in both arrangements. Once with Cas12a targeting
FANCF and SpCas9 targeting VEGFA and once vice versa. To better assess the impact that the utilization of a fgRNA
has on the editing rates, the sgRNAs were tested separately and in one sample.
Having the sgRNA with single Cas
proteins in the same sample resulted in no clear difference in the editing rates (Fig. 7). The fusion of the gRNAs resulted in a lower editing rate overall. While the editing for VEGFA
stayed at about 20% in all cases, the editing for FANCF dropped significantly. When targeting the same gene under
the same conditions, the editing rates for MbCas12a were overall lower than the ones from SpCas9.
4.3 The Inclusion of a Linker Does Not Lower Editing Rates
To further assess the effect of the genomic locus on the editing rate, we included CCR5 as an additional gene target. For this assay, a fgRNA with a 20 nt long linker was included between the two spacers. The editing rate for VEGFA was again relatively consistent throughout the samples (Fig. 8). For CCR5, the editing rate with sgRNAs was approximately the same at about 30%. However, it dropped below 10% for the fgRNA. The addition of the 20 nt linker had no effect on the editing rates compared to no linker.
4.4 fgRNAs can be used for CRISPRa
To establish the foundation for their use as protein scaffolds, we identified the next step as demonstrating the use of fgRNAs for CRISPR activation. For this, we intend to recruit the transcriptional activator VP64 to a firefly luciferase gene to induce expression. The VP64 protein is attached to the catalytically inactive Cas9 protein, which is then guided by gRNAs to the luciferase gene. The gRNAs target a TetO sequence, which is positioned in front of the luciferase gene in multiple repeats. The firefly luciferase activity was then quantified as photon counts and normalized against Renilla luciferase, which is expressed on a separate plasmid under an ubiquitous promoter. In two biological replicates we saw similar Relative luciferase activity with fgRNA as a guide compared to a sgRNA (Fig. 9).
4.5 Stapling Two DNA Strands Together Using fgRNAs
After showing the general capability of the fgRNA
to work for editing and for CRISPR activation, the next step was to use it to staple two DNA loci together, and
thereby induce proximity between two separate functional elements. For this, an enhancer plasmid and a reporter
plasmid was used. The reporter plasmid has firefly luciferase behind several repeats of a Cas9 targeted sequence.
The enhancer plasmid has a Gal4 binding site behind several repeats of a Cas12a targeted sequence. By introducing
a fgRNA staple and a Gal4-VP64, expression of the luciferase is induced (Fig. 10, Panel A).
Different linker lengths were tested. Cells were again normalized against ubiquitous renilla expression.
Using no linker between the two spacers showed similar relative luciferase activity to the baseline control
(Fig. 10, Panel B). An extension of the linker from 20 nt up to 40 nt resulted in an increasingly higher expression of the
reporter gene. These results suggest an extension of the linker might lead to better transactivation when
hijacking an enhancer/activator.
5. References
Aregger, M., Xing, K., & Gonatopoulos-Pournatzis, T. (2021). Application of CHyMErA Cas9-Cas12a combinatorial genome-editing platform for genetic interaction mapping and gene fragment deletion screening. Nature Protocols, 16, 4722-4765. https://doi.org/10.1038/s41596-021-00595-1
Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., & Zhang, F. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science, 339, 819-823. https://doi.org/10.1126/science.1231143
Gonatopoulos-Pournatzis, T., Aregger, M., Brown, K. R., Farhangmehr, S., Braunschweig, U., Ward, H. N., Ha, K. C. H., Weiss, A., Billmann, M., Durbic, T., Myers, C. L., Blencowe, B. J., & Moffat, J. (2020). Genetic interaction mapping and exon-resolution functional genomics with a hybrid Cas9-Cas12a platform. Nature Biotechnology, 38, 638-648. https://doi.org/10.1038/s41587-020-0437-z
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337, 816-821. https://doi.org/10.1126/science.1225829
Kampmann, M. (2017). CRISPRi and CRISPRa screens in mammalian cells for precision biology and medicine. ACS Chemical Biology, 13, 406-416. https://doi.org/10.1021/acschembio.7b00657
Kleinstiver, B. P., Sousa, A. A., Walton, R. T., Tak, Y. E., Hsu, J. Y., Clement, K., Welch, M. M., Horng, J. E., Malagon-Lopez, J., Scarfò, I., Maus, M. V., Pinello, L., Aryee, M. J., & Joung, J. K. (2019). Engineered CRISPR-Cas12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing. Nature Biotechnology, 37, 276-282. https://doi.org/10.1038/s41587-018-0011-0
Koonin, E. V., Gootenberg, J. S., & Abudayyeh, O. O. (2023). Discovery of diverse CRISPR-Cas systems and expansion of the genome engineering toolbox. Biochemistry, 62, 3465-3487. https://doi.org/10.1021/acs.biochem.3c00159
Kweon, J., Jang, A.-H., Kim, D.-e., Yang, J. W., Yoon, M., Rim Shin, H., Kim, J.-S., & Kim, Y. (2017). Fusion guide RNAs for orthogonal gene manipulation with Cas9 and Cpf1. Nature Communications, 8. https://doi.org/10.1038/s41467-017-01650-w
Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013). RNA-guided human genome engineering via Cas9. Science, 339, 823-826. https://doi.org/10.1126/science.1232033
Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., Zhang, F., & Nureki, O. (2014). Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell, 156, 935-949. https://doi.org/10.1016/j.cell.2014.02.001
Pacesa, M., Pelea, O., & Jinek, M. (2024). Past, present, and future of CRISPR genome editing technologies. Cell, 187, 1076-1100. https://doi.org/10.1016/j.cell.2024.01.042
Paul, B., & Montoya, G. (2020). CRISPR-Cas12a: Functional overview and applications. Biomedical Journal, 43, 8-17. https://doi.org/10.1016/j.bj.2019.10.005
Sternberg, S. H., Redding, S., Jinek, M., Greene, E. C., & Doudna, J. A. (2014). DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature, 507, 62-67. https://doi.org/10.1038/nature13011
Zetsche, B., Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., van der Oost, J., Regev, A., Koonin, E. V., & Zhang, F. (2015). Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell, 163, 759-771. https://doi.org/10.1016/j.cell.2015.09.038
| None |