Help:Standards/Assembly/RFC10
- Registry Help Pages:
- TOC
- At-a-Glance
- FAQ
Accepted Standards: BioBrick RFC[10] | iGEM Type IIS RFC[1000]
Motivation & Discussion
The BioBrick RFC[10], developed by Tom Knight, is a standard for interchangeable parts based on idempotent assembly. BioBrick RFC[10] is currently the most commonly used assembly standard: the majority of parts in the Registry database are RFC[10] compatible, and the majority of samples in the Registry's Repositories are maintained in RFC[10] plasmid backbones. As such, using RFC[10] ensures a greater diversity when designing your synthetic biology projects.
BioBrick RFC[10] uses an alternate shortened prefix for protein coding regions to prevent a rbs-cds issues:
- Biobrick preffix:
- 5' GAATTCGCGGCCGCTTCTAG '3 for cds and parts that start with ATG. - 5' GAATTCGCGGCCGCTTCTAGAG '3 for all other parts
- Biobrick suffix: 5' TACTAGTAGCGGCCGCTGCAG '3
A major concern with BioBrick RFC[10] is that it does not facilitate the assembly of proteins, the traditional 8bp scar creates a frame-shift, while the alternate 6bp scar includes a stop codon. If you wish to assemble proteins you will want to use an RFC designed specifically for protein assembly (see below). Alternatively, scarless assembly or DNA synthesis can circumvent this issue in RFC[10].
Advantages
- standard
- well tested and documented
- native protein start codon can be preserved while using RBS parts.
- large and still growing set of parts
Disadvantages
- no protein fusion (stop codon in 6bp scar, frameshift and stop codon in 8bp scar)
Technical Specifications
Prefix and Suffix
Prefix Suffix 5' - GAATTC GCGGCCGC T TCTAGA G ...part... T ACTAGT A GCGGCCG CTGCAG - 3' EcoRI NotI XbaI SpeI NotI PstI
There is a second prefix designed for protein coding regions (parts start with ATG, see RBS-CDS issues for more info):
Prefix Suffix 5' - GAATTC GCGGCCGC T TCTAG ...part... T ACTAGT A GCGGCCG CTGCAG - 3' EcoRI NotI XbaI SpeI NotI PstI
Scar
Assembling two parts leaves the following scar:
5' [part A] TACTAGAG [part B] 3'
The scar between a RBS and protein coding region (alternate prefix) would be:
5' [part A] TACTAG [part B] 3'
Compatibility/Illegal Sites
In order for a part to be compatible with BioBrick RFC[10] it must not contain the following restriction sites, as these are unique to the prefix and suffix:
Sequence | Type | Enzyme | Note |
---|---|---|---|
gaattc | Illegal | EcoRI | |
tctaga | Illegal | XbaI | |
actagt | Illegal | SpeI | |
ctgcag | Illegal | PstI | |
gcggccgc | Avoid | NotI |
Notes
Sources
- [http://dspace.mit.edu/handle/1721.1/45138 Draft Standard for Biobrick Biological Parts]
- [http://openwetware.org/wiki/The_BioBricks_Foundation:Standards/Technical/Formats#BBF_RFC_10:_Tom_Knight.27s_original_BioBrick_assembly_standard The BioBricks Foundation - Format Discussion]
- Old Registry RFC[10] Page
Tom Knight, a senior research scientist at MIT CSAIL, developed Assembly standard 10 in 2003. It is the most widely adopted assembly standard in synthetic biology. |
References
- [http://hdl.handle.net/1721.1/21168 Idempotent Vector Design for Standard Assembly of Biobricks] by Tom Knight
- [http://openwetware.org/images/b/bd/BBFRFC9.pdf BBF RFC 9: Idempotent vector design for the standard assembly of Biobricks] by Tom Knight, Randall Rettberg, Leon Chan, Drew Endy, Reshma Shetty, Austin Che
- [http://openwetware.org/wiki/The_BioBricks_Foundation:BBFRFC10 BBF RFC10: Draft standard for Biobrick biological parts] by Tom Knight
Accepted Standards: BioBrick RFC[10] | iGEM Type IIS RFC[1000]