Part:BBa_K3986004
ice crystal nucleoprotein（INP）
Can anchor passenger proteins to bacterial cell membranes
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 429
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 238
Determination of the expression position of the fusion protein
Verify the surface localization of INP-SerV protein by cell separation. SDS-page and western blot confirmed the expression of INP-SerV01 fusion protein in the outer membrane. After western blotting, it was found that the fusion protein was found in the EcN-IS bacterial total protein lysate (T) and the extracellular membrane fraction (OM) obtained by centrifugation, while no fusion protein was found in the intracellular membrane fraction (IM). Obvious banding. During the experiment, the empty EcN-pSB1A3 was used as a control, and it was found that there was no expression of fusion protein in the cytoplasm, intracellular membrane, and extracellular membrane components, as shown in Figure 3-2. The results show that INP-SerV01 uses INP-N as the anchor motif and is expressed on the outer membrane of E. coli Nissle 1917. Previous studies have shown that the specific band of the INP-FDH fusion protein appears in the OM fragment of E. coli expressing MBP-INP-FDH, but it is not in the predicted size of IM, cytoplasmic protein component or all subcellular component controls. Obvious bands were detected, indicating that the MBP-INP-FDH fusion protein has been successfully displayed on the cell surface [23]. The difference is that this experiment found that there are certain bands in the periplasmic component (S), so it is speculated that the fusion protein may be synthesized in the body first, and then anchored on the cell membrane surface.
Fig 3-2 Western bloting analysis of INP-SerV01 in different cell components. EcN-pSB1A3 were used as negative control.
Contributed by WHHS-Pro-China
Construction of INP-PBP Engineered Strains
Objective and Methods
The coding sequence for phosphate-binding proteins (PBPs) PstS was synthesized, along with the truncated ice nucleation protein (INP) sequence, placed upstream of PstS. Codon optimization for E. coli was performed, and the genes were cloned into the pET23b plasmid via NdeI and XhoI restriction sites, generating the recombinant plasmid (Genewiz, USA). The recombinant plasmid, driven by the T7 promoter for constitutive expression of downstream genes, was verified through sequencing (Qingke, China) and extracted using a plasmid extraction kit (TianGen, China). The plasmid was then transformed into E. coli DH5α and BL21 strains. E. coli DH5α was used for plasmid storage, while BL21 was used for plasmid expression. The engineered strains were cultured in LB medium containing ampicillin (Amp) (50 μg/mL) at 37°C.
Figure 1. Gel electrophoresis analysis of INP, PBP, and INP-PBP constructs.
Verification of INP Anchoring of PBP on the Cell Membrane
Objective and Methods
To verify whether INP successfully anchored PBP on the cell membrane, cell membrane and cytoplasmic fractions were separated, and their phosphate adsorption capacities were measured.
Experimental steps for separating cell membrane and cytoplasmic components:
Bacterial culture: The engineered bacteria were first cultured overnight in LB medium (50 mL medium). Cell collection and resuspension: After culture, centrifuge at 10,000 rpm for 1 min to collect bacterial precipitates. The precipitate was re-suspended with 10 mL PBS to ensure uniform cell distribution. Cell lysis: Breaking up cells by ultrasound. The crushing condition was 150W power, ultrasound for 1 second, interval of 3 seconds, cycle for 20 minutes to ensure complete cell lysis. Preliminary centrifugation: The broken cell mixture is centrifuged at 5,000 rpm for 10 minutes and the supernatant is collected for further separation. Ultracentricentrifugation: The collected supernatant is centrifuged at 39,000 rpm for 1 hour to separate the cytoplasmic components (supernatant) and cell membrane components (precipitate). Re-suspension of cell membrane components: The collected cell membrane precipitates were re-suspended with 2 mL PBS and gently mixed in preparation for adsorption experiments.
Figure 2: Phosphate adsorption capacity of cell membrane versus cytoplasmic fractions.
Results and Conclusion
The experimental results showed that the phosphate adsorption capacity of the cell membrane component (red column) was significantly higher than that of the cytoplasmic component (blue column), indicating that PBP was mainly located on the cell membrane and demonstrated its phosphate adsorption function here. This result is consistent with our hypothesis that INP successfully anchors PBP to the cell membrane, resulting in stronger adsorption capacity of the cell membrane components. If PBP is not successfully anchored to the cell membrane, all of the PBP will remain in the cytoplasm, resulting in higher adsorption capacity in the cytoplasmic portion and lower adsorption capacity in the cell membrane portion. Therefore, the results of the experiment verified that INP successfully located PBP on the cell membrane, and the significant improvement of the adsorption capacity of the cell membrane was the embodiment of this anchoring effect.
The results clearly validate the function of INP, that is, INP successfully anchors PBP to the cell membrane. This makes the membrane components of the engineered bacteria exhibit higher phosphate adsorption capacity, while the cytoplasmic components exhibit lower adsorption capacity. If PBP is not successfully anchored to the membrane, only the cytoplasmic portion is expected to exhibit higher adsorption capacity. The results provide important support for the phosphate recovery system based on INP-PBP, indicating that this anchoring strategy is feasible and effective for improving the phosphate adsorption effect of engineered bacteria.
Usage by team Nanjing_NFLS 2022
Team Nanjing_NFLS 2022 connected gene inaK and mlrA to construct an extracellular enzyme display system of microcystinase to degrade the microcystins in the environment. We linked the two genes consecutively onto the shuttle vector pET-23b, and then transformed it into the competent state of E. coli BL21 (DE3).
Restriction Endonuclease Digestion
The recombinant plasmid was then extracted to be identified with restriction endonuclease digestion. We separated the targeted gene inaK (537 bp) from the plasmid, and performed 20 rounds of PCR on it. This way, we obtained a larger quantity of the targeted gene, and the gel electrophoresis graph would be of better clarity. The sequence of the primers we used are listed as follows:
| Primer | Sequence (5’ to 3’) | Restriction Site |
|---|---|---|
| InaK-F | TCGAGCTCCGTCGACAAGCTTATGACTCTCGACAAGGCGTTG | HindIII |
| InaK-R | TTCCGCATGGTCTGCAAATTCTGCGGC | / |
TABLE 1 Primer sequences and Restriction Sites
We used a 200 bp ladder marker in gel electrophoresis. As shown in FIG.1, there were 3 significant bands respectively around 550 bp, 1000 bp and 1550 bp, each corresponding to inaK, mlrA and combination of the two. This indicated that the plasmid construction had been successful.
FIG.1 Restrictive Endonuclease Digestion Results
Identification of Protein Location
We separated different components of the cell by cell fractionation with ultracentrifuge. The samples of outer membrane, inner membrane and cytoplasm were obtained and stored at -4°C overnight. SDS-PAGE gel electrophoresis was performed the next day. We then used Coomassie Bright Blue to stain the gel and observe the proteins in each sample.
FIG. 2 SDS-PAGE Results after Coomassie Staining
The composite InaK + MlrA protein (56 kDa) was found in the outer membrane fraction of pET23b-inaK+mlrA transformed E. coli, verifying our construction. MlrA only (37 kDa) was found in the inner membrane fraction of pET23b-mlrA transformed E. coli, which matched previous literature’s observations. Overall, we verified the compatibility and location of the inaK-based enzyme display system.
Below is our protocol for cell fractionation: 1. The bacteria were grown at 37°C for 12h after 0.1mM IPTG induction.
2. Cells were collected by centrifuge of 6000 rpm for 10 min.
3. After 2 washes with PBS buffer, cells were resuspended in PBS containing 0.1mM EDTA and 10 μg/mL lysozyme.
4. After incubation of 2 hours on ice, the cell suspensions were treated with ultrasound sonication on ice (5 minutes, 1 cycle).
5. Intact cells were separated from the lysates with a slow centrifuge of 6000 rpm for 10 min.
6. At this point, the supernatant contained the whole cell lysates. We retrieved it with ultracentrifugation at 50,000 rpm for 1h to pellet the total membrane fraction.
7. The supernatant containing soluble cytoplasmic and periplasm fractions was collected and stored at -4°C for later assays.
8. The pellet of total membrane fraction was resuspended into PBS buffer containing 0.01 mM MgCl2 and 2% Triton X-100 for solubilizing the inner membrane, and incubated at room temperature for 30 minutes.
9. The suspension was ultracentrifuged again at 50,000 rpm for 1h. The supernatant contained the inner membrane proteins, and the pellet contained the outer membrane proteins.
10. All samples were collected and stored at -4°C for later assays.
FIG.3 Schematic of Cell Fractionation, Created with Biorender
References:
[1]. Li, L., Gyun Kang, D. and Joon Cha, H., 2004. Functional display of foreign protein on surface of Escherichia coli using N‐terminal domain of ice nucleation protein. Biotechnology and bioengineering, 85(2), pp.214-221.
[2]. Shi, H. and Su, W.W., 2001. Display of green fluorescent protein on Escherichia coli cell surface. Enzyme and microbial technology, 28(1), pp.25-34.
[3]. Liu, M., Ni, H., Yang, L., Chen, G., Yan, X., Leng, X., Liu, P. and Li, X., 2019. Pretreatment of swine manure containing β-lactam antibiotics with whole-cell biocatalyst to improve biogas production. Journal of Cleaner Production, 240, p.118070.
| None |