Part:BBa_K2136016
Description
mCherry is a red fluorescent protein used as a reporter. It is based on a fluorescent protein that was originally isolated from Discosoma sp. and it’s being largely used due to its colour and photostability compared to other monomeric fluorophores. Another important property is that, with a system such as the one in [Part:BBa_K2136010]] secretion cells partially secrete mCherry. Therefore, it’s possible to monitor, in real-time, the kinetics of the process evaluated with aliquots of the cultivation medium or the biological material in study [1]. The codon optimized mCherry for Chlamydomonas reinhardtii comes from the biobrick BBa_J06504 and it was improved to work specially with C. reinhardtii, a microscopic algae used as model organism to study photosynthesis, cellular division, flagellar biogenesis, and, more recently, mitochondrial function [2]. Our team used this codon optimized mCherry to test the promoter activity and the expression capacity of the our new plasmid for microalgae transformation gBlock1 ([Part:BBa_K2136010]] ) .
The following results are supplemented by iGEM22_UESTC-BioTech in 2022.10.11
mCherry is a red fluorescent protein. Fluorescent reporter genes for biological applications. We optimized its codon to express in Chlamydomonas reinhardtii more efficiently.[1]BBa_K4335004 is the DNA of mCherry gene derived from mushroom coral and it is codon optimized for Chlamydomonas reinhardtii .
The advantage of mcherry over other fluorescent proteins is that its color and green fluorescent protein (GFP) are co-labeled, and mcherry also has excellent light stability over other monomeric fluorescent proteins.
Protein structure of mCherry.[Image origin]
When we looked through the blast tool on the registry page, we found a part [BBa_K2136016] that was very similar to ours. This is also a codon optimized mCherry for Chlamydomonas reinhardtii.We compared the two sequences using snapgene and found that they were identical to our mcherry coding sequence.
Our optimized mCherry for Chlamydomonas reinhardtii.In addition to the optimization of codes, we also added a intron length of 145 bp .
The existence of introns in eukaryotes is an important characteristic that distinguishes them from prokaryotes. In higher organisms, introns have been reported to regulate gene expression at multiple levels. The main function of introns is to produce different exonic combinations through alternative splicing and then translate different proteins, thus increasing the complexity of the proteome. [2]
As a eukaryote, Chlamydomonas reinhardtii can express mCherry gene by adding intron.
The Top Blue Band is BBa_K2136016, the Middle Red Band is mCherry's coding sequence, and the bottom band is mCherry with introns.
Usage
We introduced the mCherry gene into plasmid [pTX2038] as its reporter gene. Using pCrRBCS2 as promoter and tCrRBCS2 as terminator, mCherry gene expression was realized.Result
Plasmid construction
To validate the mCherry sequence in our vector, we designed mCherry-f and mCherry-R primers to verify our successful assembly.
mCherry and the position of primer targeting
Electrophoregram of amplification products,M is DNA Marker.
Functional Identification
We introduced the mCherry-containing plasmid pTX2038 into Chlamydomonas reinhardtii by electroporation and observed it using Fluorescence microscope.
Fluorescence excitation of positive clones transferred into pTX2038 vector compared with wild type mCherry, together with DIC field and chlorophyll excitation as fluorescence control.
Reference
[1] Codon usage and tRNA content in unicellular and multicellular organisms. T Ikemura. Mol Biol Evol (1985) 2 (1): 13-34.[2]Parenteau, J. et al. Introns are mediators of cell response to starvation. Nature 565, 612–617 (2019).
Codon optimized mCherry for Chlamydomonas reinhardtii
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Methods
It's believed that codon-choice have been conserved during evolution course and because not all tRNA are expressed equally, specially across species, a particular DNA sequence can be codon optimised to match the most prevalent tRNAs of the host cell, improving the efficiency of protein translation [3]. So here are the changes that we made in the DNA sequence using the software GeneArt from Life Technologies:
| Before Optimization | After Optimization |
|---|---|
|
ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCA AGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCG TGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCG AGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTG AAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGAC ATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGT GAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCT TCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGA GGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCTTG CAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCA CCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACC ATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGAC GGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAGCTGA AGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTAC AAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACG TCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACA CCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTC CACCGGCGGCATGGACGAGCTGTACAAGTAATAA |
ATGGTGTCCAAGGGCGAGGAGGACAACATGGCCATCATCAAG GAGTTCATGCGCTTCAAGGTGCACATGGAGGGCAGCGTGAACGG CCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCT ACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGC CCCCTGCCCTTCGCCTGGGACATCCTGAGCCCCCAGTTCATGTA CGGCAGCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTAC CTGAAGCTGAGCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGAT GAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACAGCAGC CTCCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACC AACTTCCCCAGCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTG GAGGCCAGCAGCGAGCGCATGTACCCCGAGGACGGCGCCCTGAAG GGCGAGATCAAGCAGCGCCTGAAGCTGAAGGACGGCGGCCACTAC GACGCCGAGGTGAAGACCACCTACAAGGCCAAGAAGCCCGTGC AGCTGCCCGGCGCCTACAACGTGAACATCAAGCTGGACATCACCAGC CACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCGCTG AGGGCCGCCACAGCACCGGCGGCATGGACGAGCTGTACAAGTAA |
After codon optimization, sequences had 94.51% of similarity (672/711 bp).
We successfully amplified the codon optimized mCherry, which has 711 bp, as can be seen in Figure 1.
Figure 1: Gel electrophoresis of mCherry+pSB1C3 construct
After ligating the sequence in the pJP22, we wanted to find the best way to transform C. reinhardtii, we tested Sapphire Blue, TAP medium and water as buffers during the electroporation. Then, cells were plated in Agar-TAP medium Petri dishes with different concentrations of Zeocin (an antibiotic from Bleomycin family) because the plasmid used had a sequence for Bleomycin resistance.
After 7 days we selected clones from previous dishes and started new cultures in a 96 well plate with 200 uL of TAP medium per well, agitation of 800 rpm, 25°C +- 1°C and 80 μE m−2 s−1 luminosity and a clear film sealing the plate. We also filled some wells with wild C. reinhardtii, just TAP medium or just mCherry as controls.
Figure 2: Cultivation setup for screening
For a better characterization of mCherry we’ve measured its excitation and emission spectra using a Tecan M200 Pro Microplate reader. In the 96 well plate we’ve measured the excitation and emission spectra of transformed C. reinhardtii supernatant, wild C. reinhardtii supernatant, water, TAP medium, transformed C. reinhardtii with spent TAP, wild C. reinhardtii with spent TAP, washed transformed C. reinhardtii with fresh TAP and washed wild C. reinhardtii with fresh TAP. For mCherry fluorescence detection we used excitation wavelength at 575 nm and emission at 608 nm, for inactive mCherry we used excitation wavelength at 410 nm and emission at 461, for Chlorophyll fluorescence we used 440 nm for excitation and 680 nm for emission. We also measured the absorbance at 750 nm for cellular concentration.
The TOP 5 mCherry-producer clones were E 10, which was transformed with TAP medium, and B1, B5, B6 and B11, which were transformed with Sapphire Blue as can be seen in Figure 3.
Figure 3: TOP 5 mCherry producers in the first screening Figure 4: TOP 5 mCherryproducers in the second screening
Before purifying we wanted to see by our own eyes that mCherry was present in our samples. In order to do that, we used a fluorescence microscope. mCherry is shining bright like a diamond in the sky in Figure 5 and 6.
Figure 5: Fluorescence microscopy of C. reinhardtii. A - Measuring mCherry fluorescence. B- Measuring chlorophyll fluorescence. C - Open field image. D - Superposition of A,B and C.
Figure 6: 3D Fluorescence microscopy of C. reinhardtii. Chlorophyll is fluorescing in green and mCherry is fluorescing in red.
Besides the previous method, we also wanted to see mCherry present in the cell’s supernatant. For that, we made the following qualitative analysis schematized in Figure 7:
Figure 7: Experimental setup for qualitative detection of mCherry.
This special filter is able to block the laser light and at the same time allows the light emitted by mCherry to pass through it, as shown in Figure 8.
Figure 8: Spectra of experimental setup components
Our results are shown below in Figures 9.
Figure 9: Laser passing through cellular supernatant. A - Laser is passing through a wild type C. reinhardtii supernatant. B- Laser is passing through a transformed C. reinhardtii producing mCherry.
So we achieved to implement an efficient protein expression and secretion system for Chlamydomonas for the first time in iGEM!! Corroborating, one more time, to our proof of concept.
We used Fast Protein Liquid Chromatography (FPLC) to analyse and purify our mCherry. FPLC is an Ion exchange purification that exploit the net electrostatic charges of proteins, in pH values different of their pI (Isoelectric point). We developed a purification protocol to mCherry. First, we performed a gradient purification to establish the best salt concentration to elute mCherry.
Gradient Set Up:
Column: Resource Q (6 mL) - GE HealthcareBuffer A: Sodium Phosphate 50 mM, pH7.5
Buffer B: Sodium Phosphate 50 mM, pH7.5 + 1M NaCl
Equilibration: 2 column volume (CV)
Injection: 0.5mL 40X Concentrate supernatant sample
Gradient length: 20 CV
Flow rate: 5mL/min
Fractionation: 5mL to unbound and 3 mL to the rest of the method
We obtained the following result (Figure 10).
Figure 10: Chromatogram of gradient mCherry purification. Green line (-) is the UV sensor reading. Red line (-) is buffer B percentage in the mixture. Black line (-) is the conductivity measurement. Blue line (-) is the fluorescence measurement of fractionated samples.
UV absorbance curve integration allow us to estimate the amount of protein separated from mCherry, 99% of all protein detected by the sensor was separated from mCherry fractions.
To further develop or method and reduce processing time, we developed a step based purification method (Figure 2). We kept 0% of B after injection for 3 CV, increase it a little bit to 0.7% of B to try to remove mCherry in this fraction, followed by a 100% of B step. This strategy was performed in a slower flow rate (3mL/min), and allow us to separate mCherry from 2 peaks in the beginning of the method. mCherry still left in the 0% step, but this method proved to be efficient, 99,7% of detected proteins were separated from mCherry.
Step based purification Set Up:
Column: Resource Q (6 mL) - GE Healthcare
Buffer A: Sodium Phosphate 50 mM, pH7.5
Buffer B: Sodium Phosphate 50 mM, pH7.5 + 1M NaCl
Equilibration: 2 column volume (CV)
Injection: 0.5mL 40X Concentrate supernatant sample
Step1: 3 CV
Step2: 2 CV
Step3: 5 CV
Flow rate: 3mL/min
Fractionation: 5mL to unbound and 1 mL to Step1, 3 mL to Step 2 and 5 mL to step 3.
We obtained the following result (Figure 11).
Figure 11: Chromatogram of step based mCherry purification. Green line (-) is the UV sensor reading. Red line (-) is buffer B percentage in the mixture. Black line (-) is the conductivity measurement. Blue line (-) is the fluorescence measurement of fractionated samples.The samples purified from this method were used to further characterize our mCherry produced by Chlamydomonas reinhardtii. The Excitation/Emission spectrum (Figure 12) obtained are similar to the ones available to mCherry.
Figure 12: Excitation/Emission spectrum of mCherry produced and purified from Chlamydomonas supernatant.
[1] Improved monomeric red, orange and yellow fluorescent proteins derived from Discosomasp. red fluorescent protein.Nathan C Shaner, Robert E Campbell, Paul A Steinbach, Ben N G Giepmans, Amy E Palmer & Roger Y Tsien. Nature Biotechnology 22, 1567 - 1572 (2004) Published online: 21 November 2004 | doi:10.1038/nbt1037. http://www.nature.com/nbt/journal/v22/n12/full/nbt1037.html
[2] Chlamydomonas reinhardtii: the model of choice to study mitochondria from unicellular photosynthetic organisms. Funes S1, Franzén LG, González-Halphen D. Methods Mol Biol. 2007;372:137-49. doi: 10.1007/978-1-59745-365-3_10. https://www.ncbi.nlm.nih.gov/pubmed/18314723
[3] Codon usage and tRNA content in unicellular and multicellular organisms. T Ikemura. Mol Biol Evol (1985) 2 (1): 13-34.
[4] Computational genomics of photosynthetic organisms. Julian Andres Mina Caicedo & Francisco J. Romero-Campero.
| None |