Part:BBa_K1884005
PsbA
This part is a coding gene that can transcript into microRNA named by the gene its regulate.
Biology
The protein which is regulated by this gene is D1 protein coded by PsbA, which forms the reaction core of PSII as a heterodimer with the D2 protein. In higher plants, the N-terminal residues of both proteins, which are exposed to the stromal surface, can be reversibly phosphorylated. After insertion in the membrane, the C-terminal of the D1 protein is cleaved by a C-terminal processing protease to yield the mature protein . This processing is essential for the assembly of a functional 4-atom manganese cluster, which involves binding to a highly conserved C-terminal alanine 344. The Mn cluster is located on the lumenal surface of the D1 and D2 proteins. In addition to the Mn cluster, the D1/D2 core binds to a number of cofactors, including two pheophytin molecules, only one of which is phytochemically active; non-haem iron; and two quinones, Qa (bound to D2) and Qb (bound to D1). Upon light excitation, an electron is transferred from the primary donor (chlorophyll a) via intermediate acceptor pheophytin to the primary quinone Qa, then to the secondary quinone Qb. At the oxidising side of PSII, a redox-active residue in the D1 protein reduces P680, the oxidised tyrosine then withdrawing electrons from a manganese cluster, which in turn withdraw electrons from water, leading to the splitting of water and the formation of molecular oxygen. PSII thus provides a source of electrons that can be used by photosystem I to produce the reducing power (NADPH) required to convert CO2 to glucose.
Design Notes
In order to select the most appropriate sequence targeting to D1 gene, a web-based tool for amiRNA design was used to develop our mature amiRNA-D1 (WMD3, http://wmd3.weigelworld.org/cgi-bin/webapp.cgi). amiRNA-D1 (5’- TATGTTGCAGTAAGAAGACAG -3’) is complementary to nucleotides 91-111bp of the coding region of D1, while the amiRNA-D1* sequence (5’-CTGTCTTCTTACTGCAACATA-3’) is used to maintain the structure of the amiRNA duplex. The constructed Pre-amiRNA-D1 (154 bp) was commercially synthesized in vitro and was cloned in plasmid pUC57 (Sangon Biotech Co., Ltd, Shanghai, China). The final construction of pH124-amiRNA-D1 was completed by inserting Pre-amiRNA-OEE2 into an empty pH124 vector with the help of two previously designed recognition sites Nhe I and PmaC I. The mature parts (miRNA/miRNA* duplex) are shown in the box. The sequences corresponding to the mature miRNAs are shown in green and the sequences corresponding to the miRNA*s are shown in red. Nhe I and PmaC I sites are added at the left and right arms of the precursor of miRNA1162, respectively.
Usage
PsbA is 141bp in length. Fig 1 shows the DNA sequence of PsbA is successfully amplified by PCR from psi-Check2 vector. From this electrophoretogram, we can see the brightness of PsbA PCR product is rather high compared with DNA Marker, which indicates that the PCR product of PsbA is in a high concerntration.
For confirming the gene of our fusion protien gene has been transformate into green algae, we extracted genome DNA of green algae and designed a pair of primers in order to amplify PsbA respectively. Fig 2 shows the DNA sequence of PsbA are successfully amplified by PCR from psi-Check2 vector. From this electrophoretogram, we can see the brightness of PsbA PCR product is rather high compared with DNA Marker, which indicates that the PCR product of PsbA are in a high concentration.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NotI site found at 20
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
| None |