Coding

Part:BBa_K2306012

Designed by: Jeroen Jacques   Group: iGEM17_TUDelft   (2017-10-13)


Cas13a with purification tags

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 70
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 260
    Illegal BglII site found at 845
    Illegal BglII site found at 2006
    Illegal BglII site found at 2480
    Illegal BamHI site found at 1
    Illegal BamHI site found at 451
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


This BioBrick is a sequence encoding the gene for the protein Cas13a (Gootenberg et al. 2017) including tags for protein purification. It does not include the double repeat/spacer sequence to define the target of the Cas13a, but only encodes for the protein itself. It can be used in combination with BBa_K2306013 which is the double repeat/spacer sequence unique to Cas13a. Cas13a is a protein that, upon recognition of its target RNA sequence which is encoded in the spacer sequence, cleaves the target RNA and then engages in collatoral cleavage of RNA in its surroundings in an aspecific manner.


Usage and Biology

This cas13a protein is an ortholog of Cas13a from Leptotrichia wadei (LwCas13a), which displays greater RNA-guided RNase activity relative to Leptotrichia shahii Cas13a (LshCas13a)[1]. Cas13a is part of the CRISPR (Clustered Regularly interspaced Short Palindromic Repeat) Cas system: Class II, Type VI family of CRISPR-Cas systems. This system is an adaptive bacterial and archaeal defense system protecting the cells from invading phages and other harmful mobile genetic elements. These RNA-guided and RNA-activated RNA endonucleases are characterized by their ability to cleave target RNAs complementary to the crRNA-spacer sequence, as well as bystander RNAs in a sequence-nonspecific manner. Due to cleavage of cellular transcripts they induce dormancy in the host cell and thus protect the bacterial population by aborting the infectious cycle of RNA-phages [2].

Characterization

Introduction

Here we report the characterization of a Cas13a enzyme from Leptotrichia wadei done by team IGEM Montpellier 2022. In order to fully characterize the cas13a biobrick, it had to be expressed, purified and tested for its in vitro functionality.


The plasmid pC013 (containing LwCas13a) with a T7 promoter and a N-terminal His-tag were ordered from Addgene in stab culture format transformed into Rosetta (Fig1).

Figure 1. pC013 plasmid containing the cas13 gene and the his-tag.
Figure 1. pC013 plasmid containing the cas13 gene and the his-tag.


The coding sequence of Cas13a in this biobrick (BBa_K2306012) is not perfectly aligned with the one we purified but this protocol could encompass all cas13 families with an His-tag.

Upstream processing: Expression

Cultivation Procedure

The Cas13a was expressed according to the protein expression protocol on our wiki. To summarize, TB media was inoculated with an overnight culture at OD600 ~0.06 and grown to OD600 ~0.6 in 5L shake flasks at 37 °C with 190 rpm. At this point, the cells were placed on ice for 30 min and induced with 1mM IPTG. The cells were then incubated for 16 hours at 21 °C and 190 rpm, for production of the Cas13a protein. After expression, the cells were harvested using centrifugation at 5000 rpm for 15 minutes and 4°C.

Downstream processing: Purification

Purification Procedure

The processing was adapted from a protocol published by Kellner et al [3]: pC013 contains two tags, a SUMO tag and a His tag. We decided to purify the Cas13 only using the Hist tag without cleaving the SUMO tag. And so we developed our own Cas13a protein purification protocol on our wiki. To summarize, the cells were lysed with a high pressure homogenizer in the lysis buffer (20 mM Tris-HCL, 166 mM NaCl, 1 mM DTT, pH 8.0). Once they have been homogenized, the cells are passed through a french press. After clarifying the lysate via centrifugation for 1h at 10 000 rpm at 4°C, the Cas13a protein was purified using an HisTrap HP column followed by size exclusion chromatography.

Results

To check whether we have the protein in the fraction collected from the HisTrap column, we ran an SDS-PAGE gel (Fig2).


Figure 2. SDS-page gel of fractions collected after the His-trap column. The first lane displays a sample of lysed bacteria before his-tag purification. The second lane displays the flow-through form lysis buffer. Lanes 3 to 5 show the different elution fractions. There is a clear band at 140 kDa correlating with the mass of our protein.
Figure 2. SDS-page gel of fractions collected after the His-trap column. The first lane displays a sample of lysed bacteria before his-tag purification. The second lane displays the flow-through form lysis buffer. Lanes 3 to 5 show the different elution fractions. There is a clear band at 140 kDa correlating with the mass of our protein.

As you can see, the fractions are not pure, so we ran a SEC with a membrane of 3 Kda pores: our protein will not be lost because it is bigger than that. We collected the fraction from SEC and ran an SDS-PAGE to view our protein.

Figure 3. SDS-page gel of fractions collected after the SEC. The first lane displays a sample before injection into the SEc (BI). Lanes 3 to 5 show the different elution fractions. There is a clear band at 140 kDa correlating with the mass of our protein.
Figure 3. SDS-page gel of fractions collected after the SEC. The first lane displays a sample before injection into the SEc (BI). Lanes 3 to 5 show the different elution fractions. There is a clear band at 140 kDa correlating with the mass of our protein.


The last step was concentrating our protein and achieving a concentration of 2 mg/mL of protein. Then our protein was stored at -80°C.


Finally, in vitro functionality was tested with two assays: colorimetric based lateral flow detection assay, and fluorescence-based detection assay to check for proper activity of Cas13a.

In vitro functionality testing: colorimetric based lateral flow detection assay

Assay Procedure

The in vitro functionality was tested according to the colorimetric based lateral flow detection assay protocol on our wiki. To summarize, the tube contains the enzyme (Cas13a), the guide RNA (crRNA) and the probes. The probe is a 15 uridine RNA molecule labeled with biotin in 5’ and FAM (6-fluorescein amidite) in 3’. To the reaction tube is added gold nanoparticles coupled with an anti-FITC antibody and reaction buffer. The strip contains two different types of capture molecules: a biotin ligand and an anti-rabbit antibody. Both are fixed on the strip and serve as capture antibodies. The sample is deposited on a sample pad, by capillarity the aqueous solution will migrate. Migrating with the sample the gold nanoparticles are attached to a rabbit anti-FITC antibody which recognizes specifically FITC molecules (Fig4).

Figure 4. SFunctioning of the lateral flow detection assay.
Figure 4. Functioning of the lateral flow detection assay.


Results

We worked on “synthetic sequences” published by Kellner et al. [3]. We followed the experimental procedure described in the article. Our goal was to be able to reproduce already published results to set the experimental conditions for the test. A result of such an experiment is shown below (Fig5).

Figure 5. SHERLOCK detection on synthetic sequence.
Figure 5. SHERLOCK detection on synthetic sequence. PC: positive control (sequence published by Kellner et al. nature protocol 2019)[3], NC: negative control without the Cas13a.

This result approved the experimental conditions as we see a positive read for the synthetic sequence.

In vitro functionality testing: fluorescence-based detection assay

Procedure

The in vitro functionality was tested according to the fluorescence-based detection assay protocol on our wiki. To summarize, we designed the cleavage reporter according to Gootemberg et al. in “Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a and Csm6” [4]. This reporter is composed of the fluorophore 6-FAM, a poly U sequence and the quencher IABkFQ. We decided to use another quencher called BHQ_1. We ordered this sequence: /56-FAM/rUrU rUrUrU rU/3BHQ_1/ from IDT.

Results

To test the specificity of the Cas13 for detecting genes we designed target sequences where we inserted punctual mutations ranging from 1 to 10 mutations per sequence (Fig6).

Figure 6. Mutation number and location in ToxR target sequence.
Figure 6. Mutation number and location in ToxR target sequence.


We can clearly see that after two mutations we don’t have any detection, so the Cas13 is highly specific (Fig7).

Figure 7. Fluorescence detection of the ToxR target sequence. The legend shows the number of mutations of the sequence.
Figure 7. Fluorescence detection of the ToxR target sequence. The legend shows the number of mutations of the sequence.

New contribution

Group: Aedes'n'Seek, iGEM Montpellier 2023

Summary: Making a template for targeting specific sequences (guide for LwCas13a).

Sequences used

GAAAT enhancer sequence for the T7 promoter +

TAATACGACTCACTATAG T7 promoter sequence +

GATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC scaffold sequence for LwCas13a +

Reverse complementary sequence of the target

Primers obtained

primers:

forward = GAAATTAATACGACTCACTATAGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC (will never change)

Reverse = target sequence + GTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATC (reverse complementary sequence of the LwaCas13a scaffold)


Summary

The Cas13a biobrick was fully characterized, from expression to in vitro functionality testing. The in vitro functionality testing proved that the Cas13a is functional even without cleaving the SUMO tag.


References

  1. ↑ O. O. Abudayyeh, J. S. Gootenberg, et al. C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science 353, aaf5573 (2016).
  2. ↑ Kick, L.M., von Wrisberg, MK., Runtsch, L.S. et al. Structure and mechanism of the RNA dependent RNase Cas13a from Rhodobacter capsulatus. Commun Biol 5, 71 (2022).
  3. ↑ 3.0 3.1 3.2 Kellner, Max J., et al. "SHERLOCK: nucleic acid detection with CRISPR nucleases." Nature protocols 14.10 (2019): 2986-3012.
  4. ↑ Gootenberg JS, et al. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science. 2018 Apr 27;360(6387):439-444. .
[edit]
Categories
Parameters
None