Plasmid_Backbone
pSBBs0K

Part:BBa_K823026

Designed by: Jara Radeck   Group: iGEM12_LMU-Munich   (2012-08-21)

pSBBs0K-Pspac (replicative Bacillus subtilis expression vector; IPTG inducible

This part is an expression vector for Bacillus subtilis. It is replicative both in E.coli and B.subtilis. It has an ampicillin resistance for cloning in E.coli and kanamycin resistance for selection in B. subtilis. The multiple cloning site is downstream of a Pspac promoter, that is inducible with IPTG (Isopropyl-β-D-thiogalactopyranosid).

LMU-Munich-PSBBs0K-Pspac.png


This backbone is a BioBricked version of the B. subtilis overexpression vector pDG148. Reference: Joseph et al.

For handling of B. subtilis vectors, please see here.

The transformation into B. subtilis is explained here.

CAUTION: THIS VECTOR DOES NOT WORK AS EXPECTED! THE PROMOTER IS STRONG CONSTITUTIVE INSTEAD OF IPTG-INDUCIBLE!

pSBBs0K-Pspac is a replicative expression vector with a kanamycin resistance. The IPTG (isopropylbeta-D-thiogalactopyranoside)-inducible Promoter Pspac is followed by the multiple cloning site and a terminator. Also expressed are lacY, a transporter for IPTG (naturally allolactose), and lac, the repressor. In presence of IPTG, LacI releases from the promoter and the gene of interest is expressed.

The ble gene encodes the bleomycin resisitance protein (BRP) which can be selected for by bleomycine or phleomycin in E. coli and B. subtilis. We did not use this resistance.

The presence of the vector can be checked for via colony PCR with the primers: CTACATCCAGAACAACCTCTGC and TTCGGAAGGAAATGATGACCTC. We did not perfom the colony PCR because we selected for functionality on plates with X-Gal and IPTG and we got blue colonies.

LMU-Munich-0K-OD.png

lacZ-activity in Miller units in pSBBs0K-Pspac depending on B. subtilis growth phase.

This expression vector was tested by insertion of lacZ into the multiple cloning site, transformation into W168 and ONPG assays. Overnight cultures were diluted 1:100 in LB-medium and incubated at 37°C, 230 rpm. Cells were harvested in 2 ml reaction tubes and frozen. For the induction assay, at an OD600 around 0.9 were split into 3 ml aliquots in test tubes with the given IPTG-concentrations and incubated for another hour. Data for splitting at OD600 around 0.3 is not shown, but similar.

LMU-Munich-0K-IPTG.png

lacZ-activity in Miller units in pSBBs0K-Pspac depending on IPTG concentrations.

In summary, the figures show that the expression is very strong, even without induction [in comparison to the native B. subtilis promoters] and does not change with IPTG addition. It does change depending on the growth phase, with a maximum strength in the stationary phase.

This vector was designed for overexpression of proteins, but is not inducible but constitutively active.

This BioBrick is part of the LMU 2012 igem project BacillusBioBrickBox


Note from iGEM Toulouse 2016:

This plasmid is the only replicative plasmid for Bacillus subtilis in the registry. As so, this BioBrick was improved by the iGEM Toulouse 2016 team by reducing its size down to 5827pb (compared to the 9358pb of the entire pSBBsOK -P). This makes clonings a lot more convenient. This new version is available at http://parts.igem.org/Part:BBa_K1937001. It is also described at http://2016.igem.org/Team:Toulouse_France/Description


Note that iGEM Toulouse 2016 also improved this backbone by creating from it a part that could turn any pSB1C3-based plasmid in a E.coli/B.subtilis shuttle vector. This part is named OriKan and can be found at http://parts.igem.org/Part:BBa_K1937002. While Bacillus subtilis is of huge interest for a growing number of iGEM projects, it is not easy to develop new parts as it is required that they are registered after sub-cloning in the E. coli plasmid pSB1C3. In this context, the OriKAn part opens the whole iGEM registry to Bacillus-based projects. Its construction and validation are presented at http://2016.igem.org/Team:Toulouse_France/Description.



Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 8268
    Illegal SpeI site found at 2
    Illegal PstI site found at 16
    Illegal NotI site found at 9
    Illegal NotI site found at 8274
  • 21
    INCOMPATIBLE WITH RFC[21]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 8268
    Illegal BglII site found at 5862
    Illegal BamHI site found at 1378
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal prefix found at 8268
    Illegal suffix found at 2
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal prefix found at 8268
    Plasmid lacks a suffix.
    Illegal XbaI site found at 8283
    Illegal SpeI site found at 2
    Illegal PstI site found at 16
    Illegal NgoMIV site found at 2925
    Illegal AgeI site found at 5473
    Illegal AgeI site found at 6435
    Illegal AgeI site found at 7110
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal BsaI.rc site found at 2749
    Illegal BsaI.rc site found at 4188
    Illegal BsaI.rc site found at 6704
    Illegal SapI.rc site found at 5686
    Illegal SapI site found at 1666


[edit]
Categories
//chassis/multihost
//chassis/prokaryote/ecoli
//chassis/prokaryote/subtilis
//plasmidbackbone/expression/inducible
Parameters
chassisB. subtilis + E. coli
copies
originpDG148
resistanceA(E. coli) + K(B. subtilis)