Regulatory

Part:BBa_K747096

Designed by: Lucas Schneider   Group: iGEM12_Freiburg   (2012-09-26)

CMV-promoter At first, we tried to use the CMV promotor that was included in the 2012 distribution kit. Part BBa_J52034 was submitted to the registry by Team Slovenia in 2006 and has been on the distribution kit since then (although sequencing was inconsistent every year). After numerous attempts to use this part, we sequenced it and found out that it was not a CMV promotor, but a part of the lacI gene. Reading the part’s review, we noticed that Team Munich 2010 had already pointed out that it was a lacI fragment. Interestingly, Team DTU Denmark was able to induce fluorescent protein expression with this bacterial gene fragment- magic. Since no other mammalian promoter was available on this year’s distribution kit, we designed the following primers and amplified the CMV promoter from the vector pPhi-Yellow-C:

GTTACCGGTCTCGTTAAGAATTCGCGGCCGCTTCTAGAGATAGTAATCAATTACGGGGTC CTAGAGGTCTCGCTGCCTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAAC

After incorporation of these primers into the CMV promoter, amplification product, the promoter is not only flanked by the iGEM prefix and suffix, but also by distal BsaI restriction sites. This way, we were able to directly assemble the PCR product.

Improvement by Calgary 2018

Part BBa_K2605001 is an improvement of this part done by the 2018 iGEM Calgary team. A SalI restriction site (sequence: GTCGAC) was added to the 5' end of the promoter, which allows for the promoter to be used within the 2018 iGEM Calgary's Multiple-Cloning Site flanked by FRT sites Part BBa_K2605002.


Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
//promoter
Parameters
None