Part:BBa_K4974004
Human Alpha-Amylase
This part is the coding sequence for the alpha-amylase protein. Alpha-amylase is involved in the process of starch digestion. Alpha-amylase hydrolyzes the α-1,4-glycosidic bonds in starch and related polysaccharides such as amylose, amylopectin, and glycogen. The protein is primarily produced by the pancreas and salivary glands in mammals like humans. Alpha-amylase has also been shown to play a role in the human body's acute stress response. The HPA axis mediates the production of alpha-amylase, and causes a significant increase in salivary alpha-amylase production in response to acute stress.
This part can be expressed in Gibson cloning vectors to produce alpha-amylase protein in BL-21 e. coli, as was done by the 2023 NYCEmpireState team.
If a team orders the human alpha amylase sequence, they can dissolve it in the proper solvent (i.e. ddH2O or TE). To increase the efficiency and the amount of the product, conduct a PCR assay using following primers: 5’ CTATAGGGGAATTGTGAGCGG 3’ (forward) and 5’ TAGCAGCCGGATCTCAGTG 3’ (reverse)
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 1363
- 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 1363
- 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 1363
- 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 1363
Illegal NgoMIV site found at 370
Illegal NgoMIV site found at 1377
Illegal AgeI site found at 472 - 1000COMPATIBLE WITH RFC[1000]
None |