Part:BBa_K4858008
F2RL3 Sink2 Probe
The F2RL3 Sink2 Probe is tailored to detect the PAR4 mutation within the F2RL3 gene, a mutation recognized for elevating thrombin activity, leading to a heightened risk of blood clot formation. The function of the Sink2 strand is two-fold, dependent on the template type present in the solution. In the presence of the SNP template, this sink strand will preferentially bind to the Sink1 strand while the fluorescent probe binds to the template containing the SNP, thus leading to increased fluorescence. In contrast, in the presence of the template without the SNP, this sink strand will not bind to the Sink1 strand, as the quencher will bind to the fluorophore, and the Sink1 strand will bind to the template DNA. The purpose of the Sink2 strand is to act in tandem with the other sink strand as a competitive inhibitor, ensuring any excess fluorescent probe does not nonspecifically bind to the quencher, thereby promoting maximal differential fluorescence. The sink strand increases the specificity of the probe, ensuring that fluorescence only occurs when the probe binds to the desired target.
Figure 1: Summary of Differential Fluorescence Achieved through Machine-Learning Based Algorithm of Designing Probes
Usage and Biology
General Design
This sink strand consists of a single-stranded DNA segment that acts to bind the Sink1 strand in the absence of the SNP.
With amplified F2RL3 from our ordered fragments containing either the G or A variant of rs773902, we began testing our fluorescent probes. To facilitate this process, we combined raw amplification products with a mixture of each of the probes at 1 µM, according to the procedure described in Hyman et al. (2022) [1]. After mixing, the temperature was increased to 95 °C and then allowed to slowly cool back to room temperature. We expected to observe differential fluorescence between samples with different F2RL3 alleles. However, as seen below, we did not observe any meaningful differences between samples over numerous trials (Figure 2).
Figure 2: Fluorescence of probe-quencher-sinks-LAMP product mixture by temperature, as read by qPCR machine. This trial was representative of the several we conducted but do not show here. As the annealing samples approach room temperature, we expect them to show differential fluorescence between alleles with higher fluorescence for F2RL3 Thr in a successful test. However, this was not observed.
We proceeded to again evaluate the efficacy of our probes on the products of each primer set, including the digestible product (NEB1), but again failed to observe convincing differential fluorescence in any condition (Figure 3). We recognize that our probe reaction optimization experiments should be repeated on this improved product, but did not have time in the short iGEM season to conduct such testing.
Figure 3: Fluorescence of probe-quencher-sinks-LAMP product mixture by primer set, as read by qPCR machine. shows fluorescence data of probe reactions with LAMP product produced with each primer set. No condition showed convincing differential fluorescence.
Design Steps
The first step is to check the location of the LAMP Primers used to amplify the target sequence. You must use a segment between the F2 and F1 binding sites (as seen in the FIP primer given by the NEB LAMP Primer Calculator). You must then input the sequence with and without the SNP into the probe design calculator designed and utilized in Hyman et al. (2022) [1].
The two sequences inputted were: CTGCTGATGAACCTCGCGGCTGCTGACCTCCTGCTGGCCCTGG as our wild-type sequence (the Thr-containing variant in actuality) and CTGCTGATGAACCTCGCGACTGCTGACCTCCTGCTGGCCCTGG as our mutated sequence (the Ala-containing variant in actuality). Note that here, we swapped which sequence was inputted in which box, which means that we should see increased fluorescence in the Ala-containing variant after running a fluorescence assay!
This should yield four different sequences, one fluorophore, one quencher, and two different sink strands, as seen below in Figure 4.
Figure 4: Example of Our Input for Machine-Leaning Algorithm that Designs Probes
Usage
The DNA fluorophore-quencher pair of probes consists of a fluorophore and a quencher. When the probe is intact, the proximity of the quencher to the fluorophore prevents fluorescence. However, if the target sequence (in this case, the mutation in the PAR4 gene) is present, the fluorescent probe binds to the sequence, separating the fluorophore from the quencher to induce fluorescence. In the meantime, when the SNP is present, the two Sink sequences bind to each other. However, when the SNP is absent, the Sink1 strand binds to the target sequence while the fluorophore binds the quencher to attenuate fluorescence.
The presence of the SNP leads to more favorable binding between the fluorophore and the template strand and between the two sink strands than between the fluorophore and quencher and between the Sink1 strand and the template strand, thereby increasing fluorescence. In contrast, the absence of the SNP leads to more favorable binding between the fluorophore and the quencher and the Sink1 strand with the template strand than between the fluorophore and the template strand and between the two sink strands, thereby reducing fluorescence. These complex thermodynamic equilibria can be characterized below (Figure 5).
Figure 5: Thermodynamic Equilibria that Promote Increased Fluorescence in the presence of the SNP
For optimal performance and to validate the sink's effectiveness, test the probe in the presence and absence of the sink. A reduced number of false positives in the presence of the sink would indicate its efficacy in enhancing probe specificity. We recommend testing the probes at 1 uM mixed with 10 uL of LAMP mixture, as mentioned in Hyman et al. (2022) [1]. Titration and changing ratios of probes may help enhance differential fluorescence.
References
1. Hyman, L. B., Christopher, C. R., & Romero, P. A. (2022). Competitive SNP-lamp probes for rapid and robust single-nucleotide polymorphism detection. Cell Reports Methods, 2(7), 100242. https://doi.org/10.1016/j.crmeth.2022.100242
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
| None |