Part:BBa_K4858000

F2RL3 Fluorescent Probe (ProbeF)

The F2RL3 Fluorescent Probe (ProbeF) is tailored to detect the PAR4 variant within the F2RL3 gene, a variant recognized for elevating thrombin activity, leading to a heightened risk of blood clot formation. The probe's fluorescence mechanism employs a fluorescent probe and a quencher. In its native state, the quencher remains in close proximity to the fluorophore, effectively suppressing any fluorescence. However, upon hybridizing to the DNA sequence bearing the PAR4 mutation in F2RL3, a conformational change occurs. This alteration distances the quencher from the fluorophore, leading to a marked fluorescence signal. The magnitude of this signal indicates the presence and quantity of the target mutation, positioning the probe as a vital tool for molecular diagnostics, thrombotic condition research, and potential therapeutic monitoring.

Figure 1: Summary of Differential Fluorescence Achieved through Machine-Learning Based Algorithm of Designing Probes

Usage and Biology

General Design

This fluorophore consists of a single-stranded DNA segment attached to a 5' 6-FAM (fluorescein) probe. The emission max wavelength is 520 nm., and its absorption max wavelength is 495 nm.

With amplified F2RL3 from our ordered fragments containing either the G or A variant of rs773902, we began testing our fluorescent probes. To facilitate this process, we combined raw amplification products with a mixture of each of the probes at 1 µM, according to the procedure described in Hyman et al. (2022) [1]. After mixing, the temperature was increased to 95 °C and then allowed to slowly cool back to room temperature. We expected to observe differential fluorescence between samples with different F2RL3 alleles. However, as seen below, we did not observe any meaningful differences between samples over numerous trials (Figure 2).

Figure 2: Fluorescence of probe-quencher-sinks-LAMP product mixture by temperature, as read by qPCR machine. This trial was representative of the several we conducted but do not show here. As the annealing samples approach room temperature, we expect them to show differential fluorescence between alleles with higher fluorescence for F2RL3 Thr in a successful test. However, this was not observed.

We proceeded to again evaluate the efficacy of our probes on the products of each primer set, including the digestible product (NEB1), but again failed to observe convincing differential fluorescence in any condition (Figure 3). We recognize that our probe reaction optimization experiments should be repeated on this improved product, but did not have time in the short iGEM season to conduct such testing.

Figure 3: Fluorescence of probe-quencher-sinks-LAMP product mixture by primer set, as read by qPCR machine. shows fluorescence data of probe reactions with LAMP product produced with each primer set. No condition showed convincing differential fluorescence.

Design Steps

The first step is to check the location of the LAMP Primers used to amplify the target sequence. You must use a segment between the F2 and F1 binding sites (as seen in the FIP primer given by the NEB LAMP Primer Calculator). You must then input the sequence with and without the SNP into the probe design calculator designed and utilized in Hyman et al. (2022) [1].

The two sequences inputted were: CTGCTGATGAACCTCGCGGCTGCTGACCTCCTGCTGGCCCTGG as our wild-type sequence (the Thr-containing variant in actuality) and CTGCTGATGAACCTCGCGACTGCTGACCTCCTGCTGGCCCTGG as our mutated sequence (the Ala-containing variant in actuality). Note that here, we swapped which sequence was inputted in which box, which means that we should see increased fluorescence in the Ala-containing variant after running a fluorescence assay!

This should yield four different sequences, one fluorophore, one quencher, and two different sink strands, seen below in Figure 4.

Figure 4: Example of Our Input for Machine-Leaning Algorithm that Designs Probes

Due to our product being a custom-designed fluorescent probe, there is not a publicly available structure. We instead generated the following PDB file using the sequence for F2RL3 containing the mutation using Pymol, which then served as the basis for our molecular dynamic investigations (Figure 5).

Figure 5: DNA Fluorescent Probe binding to F2RL3 template with PAR4 Thr Variant

Usage

The DNA fluorophore-quencher pair of probes consists of a fluorophore and a quencher. When the probe is intact, the proximity of the quencher to the fluorophore prevents fluorescence. However, if the target sequence (in this case, the mutation in the PAR4 gene) is present, the fluorescent probe binds to the sequence, separating the fluorophore from the quencher to induce fluorescence. In the meantime, when the SNP is present, the two Sink sequences bind to each other. However, when the SNP is absent, the Sink1 strand binds to the target sequence while the fluorophore binds the quencher to attenuate fluorescence.

The presence of the SNP leads to more favorable binding between the fluorophore and the template strand and between the two sink strands than between the fluorophore and quencher and between the Sink1 strand and the template strand, thereby increasing fluorescence. In contrast, the absence of the SNP leads to more favorable binding between the fluorophore and the quencher and the Sink1 strand with the template strand than between the fluorophore and the template strand and between the two sink strands, thereby reducing fluorescence. These complex thermodynamic equilibria can be characterized below in Figure 6.

Figure 6: Thermodynamic Equilibria that Promote Increased Fluorescence in the presence of the SNP

For optimal performance, test the probe using well-characterized DNA samples that possess the PAR4 SNP mutation and those that do not. This would give a clear fluorescence differential, validating the probe's specificity. We recommend testing the probes at 1 uM mixed with 10 uL of LAMP mixture, as mentioned in Hyman et al. (2022) [1]. Titration and changing ratios of probes may help enhance differential fluorescence.

We expect to see that after denaturation, cooling of the mixture by 2 degrees Celsius every minute should promote optimal probe binding and differential fluorescence, as described in Hyman et al. (2022) [1].

Modeling Results

An RMSD of 9 Å suggests a significant deviation from the starting structure during denaturation of the fluorophore-quencher complex, which is expected to occur during denaturation as it allows for preferential binding. In the context of molecular dynamics (MD) simulations, this could be indicative of a large conformational change, rearrangement, or potential instability. Since the RMSD rises rapidly and plateaus or stabilizes around 9 Å, it might suggest that the probe underwent a structural change and then equilibrated in that new conformation, indicative of high structural flexibility. RMSF values indicate lower fluctuation as one moves into the core region of the DNA, which is expected, since the terminal ends tend to be more flexible in any macromolecule. These results can be summarized in Figure 7.

Figure 7: Fluorescent Probe Denaturing at 368 K, or 95 C. This is expected as we want to see the fluorophore-quencher complex dissociate so that preferential binding as described above can occur.

References

1. Hyman, L. B., Christopher, C. R., & Romero, P. A. (2022). Competitive SNP-lamp probes for rapid and robust single-nucleotide polymorphism detection. Cell Reports Methods, 2(7), 100242. https://doi.org/10.1016/j.crmeth.2022.100242

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]