Part:BBa_K4687045
MAD7+recE/T+pJYS1+PlacM:MADE/TJlacM-g5d4
The exonuclease–recombinase pair recE/T can improve dsDNA recombination efficiency in C. glutamicum. In this study, we combined the recE/T and CRISPR-MAD7 systems.Using this system, we optimized the CRISPR-MAD7 promoter sequence and screened for more efficient vector backbone and PAM recognition sites, and designed donor DNA to achieve targeted gene knockout in Corynebacterium glutamicum.
Contents
Introduction
Lycopene, a potent antioxidant terpenoid, is extensively utilized in medicine, food, and cosmetics [1]. Microbial cells, such as Corynebacterium glutamicum, can naturally produce lycopene. To enhance yields, various gene editing tools are employed in constructing high-yielding strains. These tools include counter-marker-assisted allelic exchange methods like the use of levansucrase gene SacB, streptomycin-sensitive gene rspl, 5-fluorouracil-lethal gene upp, and the Cre-loxP system [2][3].
The existing strategies face challenges due to prolonged processes and inefficiencies, leading to a significant 20%-40% false positive rate. Over the past few years, CRISPR/Cas systems have emerged as cutting-edge genome manipulation technologies across diverse organisms [4]. While CRISPR-Cas9 and CRISPR-Cpf1 systems have demonstrated high efficiency in gene editing, our contribution involves the development of a novel CRISPR-MAD7 system. This system exhibits enhanced gene deletion capabilities, particularly excelling in fragment deletion.
In the present study, MAD7 was expressed under PlacM promoter in pJYS1 plasmid. The gRNA of target gene was expressed under J23119 promoter in the same pJYS1 plasmid that containing MAD7 expression cassette. Collectively, by fusing multiple parts like MAD7, promoter, terminator and donors, etc., the final part BBa_K4687045 was constructed.
Experimental method
To delete two genes simultaneously, two sgRNAs were designed. MAD7, guided by the sgRNAs, can cleave the target sites of genes and achieve the goal of deleting two genes at one time. Figure 2 illustrated the process of deleting two genes.
Identification of function
With part BBa_K4687045, genes such as crtEb and crtR which inhibited lycopene production in Corynebacterium glutamicum ATCC13032 were deleted. The knock-out can be tested by PCR (see Figure 1) and color change (see Table1).
Compared with the PCR bands (3171 bp and 3048 bp) from wild type strain Corynebacterium glutamicum ATCC 13032, the PCR bands (2460 bp and 2307) from double deleted strain ΔcrtEbΔcrtR were shorter. Figure 3 showed the PCR results (Eb represented crtEb gene, R represented crtR gene).
Figure 3. Agarose gel electrophoresis validation of Pof double deleting strain
Meanwhile, we investigated the color change of the double deleted strain ΔcrtEbΔcrtR. Due to accumulation of lycopene, ΔcrtEbΔcrtR showed obvious red color (figure 4), indicating a higher production of lycopene.
Table 1 The color and lycopene production of deleting crtEb and crtR genes
Deleted genes | sgRNA | Color |
---|---|---|
/ | / | Yellow |
crtEb/crtR | agtgattgcttattcagcacc /cccggcatctgtaacaaagac | Red |
Application of CRISPR-MAD7 for lycopene production
Through cultivation in 250 mL flasks, lycopene was produced with a higher level. In the table 2 and figure 5, the lycopene titer in ΔcrtEbΔcrtR was 19.42 folds of that in wild strain.
Table 2 The production of lycopene
Deleted genes | Lycopene production (mg/L) | Improvement |
---|---|---|
/ | 0.40 | / |
crtEb/crtR | 7.76 | 19.42 folds |
Reference
- ↑ Story, E. N., Kopec, R. E., Schwartz, S. J., & Harris, G. K. (2010). An update on the health effects of tomato lycopene. Annual review of food science and technology, 1, 189-210.
- ↑ WANG Q, ZHANG J, AL MAKISHAH N H, et al. 2021. Advances and Perspectives for Genome Editing Tools of Corynebacterium glutamicum. Front Microbiol [J], 12: 654058.
- ↑ HUANG Y, LI L, XIE S, et al. 2017. Recombineering using RecET in Corynebacterium glutamicum ATCC14067 via a self-excisable cassette. Sci Rep [J], 7: 7916.
- ↑ LIU J, WANG Y, LU Y, et al. 2017. Development of a CRISPR/Cas9 genome editing toolbox for Corynebacterium glutamicum. Microb Cell Fact [J], 16: 205.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 7380
Illegal EcoRI site found at 13840
Illegal EcoRI site found at 14083
Illegal EcoRI site found at 14959
Illegal XbaI site found at 13057
Illegal SpeI site found at 3930
Illegal SpeI site found at 4096
Illegal SpeI site found at 10823
Illegal SpeI site found at 18777
Illegal SpeI site found at 19156
Illegal PstI site found at 6884
Illegal PstI site found at 12013
Illegal PstI site found at 13303
Illegal PstI site found at 13570
Illegal PstI site found at 14764
Illegal PstI site found at 16933 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 7380
Illegal EcoRI site found at 13840
Illegal EcoRI site found at 14083
Illegal EcoRI site found at 14959
Illegal NheI site found at 3907
Illegal NheI site found at 4073
Illegal NheI site found at 6497
Illegal SpeI site found at 3930
Illegal SpeI site found at 4096
Illegal SpeI site found at 10823
Illegal SpeI site found at 18777
Illegal SpeI site found at 19156
Illegal PstI site found at 6884
Illegal PstI site found at 12013
Illegal PstI site found at 13303
Illegal PstI site found at 13570
Illegal PstI site found at 14764
Illegal PstI site found at 16933
Illegal NotI site found at 14170 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 7380
Illegal EcoRI site found at 13840
Illegal EcoRI site found at 14083
Illegal EcoRI site found at 14959
Illegal BglII site found at 714
Illegal BglII site found at 762
Illegal BglII site found at 1083
Illegal BglII site found at 2298
Illegal BglII site found at 2950
Illegal BglII site found at 3804
Illegal BglII site found at 12866
Illegal XhoI site found at 6198 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 7380
Illegal EcoRI site found at 13840
Illegal EcoRI site found at 14083
Illegal EcoRI site found at 14959
Illegal XbaI site found at 13057
Illegal SpeI site found at 3930
Illegal SpeI site found at 4096
Illegal SpeI site found at 10823
Illegal SpeI site found at 18777
Illegal SpeI site found at 19156
Illegal PstI site found at 6884
Illegal PstI site found at 12013
Illegal PstI site found at 13303
Illegal PstI site found at 13570
Illegal PstI site found at 14764
Illegal PstI site found at 16933 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 7380
Illegal EcoRI site found at 13840
Illegal EcoRI site found at 14083
Illegal EcoRI site found at 14959
Illegal XbaI site found at 13057
Illegal SpeI site found at 3930
Illegal SpeI site found at 4096
Illegal SpeI site found at 10823
Illegal SpeI site found at 18777
Illegal SpeI site found at 19156
Illegal PstI site found at 6884
Illegal PstI site found at 12013
Illegal PstI site found at 13303
Illegal PstI site found at 13570
Illegal PstI site found at 14764
Illegal PstI site found at 16933
Illegal NgoMIV site found at 7795
Illegal NgoMIV site found at 9493
Illegal NgoMIV site found at 17471
Illegal AgeI site found at 1865
Illegal AgeI site found at 6124 - 1000COMPATIBLE WITH RFC[1000]
None |