Part:BBa_K4221029
mOrange-TEVlinker
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 43
Illegal SpeI site found at 619 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 43
Illegal SpeI site found at 619 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 43
- 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 43
Illegal SpeI site found at 619 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 43
Illegal SpeI site found at 619 - 1000COMPATIBLE WITH RFC[1000]
Usage
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.
Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA.
Using mOrange[2] as target protein can visually observe fluorescent protein (mHoneydew,target protein) showing orange fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.
Biology
Conventional Orange FPs are mainly derived from two parental proteins: Kusabira-Orange (KO) and DsRed. KO was originally isolated from stony coral Fungiaconcinna, which provides bright orange fluorescence to proteins by introducing 10 amino acid residues at its N terminus. Shaner et al. improved mHoneydew and mOrange on the basis of mRFP1, a single molecule variant of DsRed.[3]
Design Consideration
The construction includes:
mOrange is fused with a TEVlinker（GAAAACCTGTACTTCCAGGGTTCTGGT）
Reference
[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)
[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.
[3]Peng W, He P, Shi D, etal. Advances in the research and applications of orange fluorescent protein[J]. Journal of Biotechnology, 2020, 36(6):1060−1068.
| None |