Part:BBa_K4197003

Ana o 3 expression at the surface of E. coli cells sortable by FACS using mRFP1

Introduction

The mRFP1 fluorescent reporter has been added on the plasmid allowing to express the gene of cashew nut Ana o 3 (K4197007) on the surface of E. coli. Expression of mRFP1 is driven by the ihfb800 promoter (see K41970012). This red fluorescence is destined to identify the allergen expressing cells by FACS.

Construction

The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R (cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon is 1622 bp. The fragment was inserted on the linearized plasmid pET21b(+) carying the ompA_Ana o 3 fusion (K4197007) by In-Fusion.

The resulting products were transformed into Stellar cells and transformants were selected. Colonies were screened by PCR using screening_insert_R (ccgaaacaagcgctcatgagc) and screening_insert_F (ggttatgctagttattgctcagc) primers. The expected sizes of amplicons was 2944 bp with RFP and 1453 bp without RFP.

Figure 1: Verification of the insertion of RFP fragment in Ana o 3 with gel. The PCR screening was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). Colony 8 has shown the right size.

Successful colonies were further tested by digestion with NotI which cut both in the plasmid and in the mRFP1 gene (Figure 2). Correct sizes were expected to be 1178 and 6791 bp for Ana o 3.

Figure 2: Digestion by NotI of Ana o 3 with mRFP1 insertion. The digestion product was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). colonies 21 and 23 present the correct size for Ana o 3.

Validation

This construction has not shown red fluorescence on the microscope. After sequencing, a mutation has been revealed on the mRFP1 sequence which does not allow us to continue further with this construction.

DAISY Project

DAISY (INSA-UPS 2022)

Sequence and Features

Assembly Compatibility:

10
INCOMPATIBLE WITH RFC[10]
Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
12
INCOMPATIBLE WITH RFC[12]
Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal NheI site found at 1703
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal NotI site found at 1519
Illegal NotI site found at 2697
21
INCOMPATIBLE WITH RFC[21]
Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal BglII site found at 1592
Illegal BamHI site found at 1735
Illegal XhoI site found at 2706
23
INCOMPATIBLE WITH RFC[23]
Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
25
INCOMPATIBLE WITH RFC[25]
Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal AgeI site found at 329
Illegal AgeI site found at 1360
Illegal AgeI site found at 1472
1000
INCOMPATIBLE WITH RFC[1000]
Illegal SapI.rc site found at 2368