Part:BBa_K4016029
VH_CyclinE1-CIB1
This fusion protein is combined VH_CyclinE1 (Part:BBa_K4016006) with CIB1 (Part:BBa_K2980002).
Usage and Biology
VH_cyclinE1 is produced from heavy chain variable region gene. VH_cyclinE1 module is designed to interact with VK_cyclinE1 and form a folded conformation, which can recognize cyclinE1 and generate its degradation.[1]
CIB1 will interact with CRY2 (Part:BBa_K2980000) under blue light stimulation. It is the main light control element in our system. By combining these two domains, we can achieve precisely binding to CyclinE tightly and specifically when there is blue-light to regulate the degradation process.
Special design
VH_cyclinE1 comes from hybridoma-rearranged heavy chain variable region gene in HE12 and HE172 hybridomas. By the same way, VK_cyclinE1 is produced from light chain variable region gene. We assumes that VH and VK will take on a folded conformation when they are adjacent in three-dimensional space, and thus recognize and bind to CyclinE tightly and specifically.
The expression of full-length ScFv can directly degrade the targeted protein, but can not prove the degradation effect of the system. Therefore, we separate the CyclinE1 into VH_cyclinE1 and VK_cyclinE1 to improve the verification method of the degradation effect of protein, and avoided the invalid experiment caused by the expression of ScFv.
Characterization
This part was validated through four ways:PCR, enzyme digestion, sequencing and functional test.
PCR
The PCR is performed with Green Taq Mix by Vazyme.
F-Prime: 5’- CTAGCGTTTAAACTTAAGCTTGCCACCATGGAGGTTCAACTGGAGGAGTCTG-3’
R-Prime: 5’- TGGATATCTGCAGAATTCTTAttaGATGTAGTCGGTCTTCTC-3’
The PCR protocol is selected based on the Users Manuel. The Electrophoresis was performed on a 1% Agarose gel.
Enzyme Digestion
After the assembly ,the plasmid was transferred into the Competent E. coli DH5α). After culturing overnight in LB, we minipreped the plasmid for cutting. The preparation of the plasmid was performed with TIANprep Mini Plasmid Kit from TIANGEN. The cutting procedure was performed with XbaI and KpnI restriction endonuclease bought from TAKARA.
The plasmid was cutted in a 20μL system at 37 ℃ for 2 hours. The Electrophoresis was performed on a 1％ Agarose glu.
Sequecing
The plasmid was sequenced correct.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 472
- 1000COMPATIBLE WITH RFC[1000]
Functional test
We used CCK-8 to observe the cell proliferation, and further evaluate the degradation effect of our system.
Method
1.Inoculate cells in a cell culture flask or dish, and allow cells to adhere or grow for approximately 4–24 hours before proceeding with the assay.
2.Apply the experiment group with blue light stimulus (480nm, stimulate 2 seconds with a 58 second-interval) for 24/48/72h before sampling and analysis assay.
3.Add 110 volume of Cell Counting Kit-8 (CCK-8) directly to cells in culture medium. Mix thoroughly to achieve a homogenous solution by lightly tapping the outside of the plate several times while avoiding bubbles. For 96-well plate, add 10 µl Cell Counting Kit-8 (CCK-8) per 100 µl culture medium.
4.Incubate in a cell culture incubator for 0.5 to 4 hours at 37°C until the color turns orange. Over incubation will give false results.
5.Record results using microplate reader to measure the absorbance of Cell Counting Kit-8 (CCK-8) at 450 nm. Recommended OD values range between 0.8-1.5, however values between 0.5-2.5 are acceptable.
6.Optional: Add 10 µl of 1 % SDS (dissolve 0.1 g SDS with PBS buffer to prepare 10 ml solution) directly to 100 µl of cells to stop the reaction. Signals can be read within 3 days without affecting the absorbance values.
7.Calculation of cell viability: Cell viability (%) = [A (Drug+) – A (Black)] [A (Drug-) – A (Black)] x 100% A (Drug+) : OD value of wells with cells, CCK-8 and drugs; A (Drug-) : OD value of wells with cells, CCK-8, but without drugs; A (Black): OD value of wells with culture medium and CCK-8, but without cells.
Result
To validate our system can be regulated by blue light and apply to practical situations, we designed part VH_CyclinE1-CIB1 (Part:BBa_K4016029) and part VK_CyclinE1-Trim21-Cry2 (Part:BBa_K4016030), which VH_CyclinE1 and VK_CyclinE1 can together target to CyclinE1 thus regulating the cell cycle as well as reponse to blue light regulation. The result showed a significant decrease of 450nm absorbance compared to the control group, indacating that in the experimental group, the growth of cells was inhibited. The result successfully proved our system can work as we expected—response to the regulation of blue light, then target and degrade CyclinE1, therefore apply to some trearments and other fields.
Reference
[1] Strube RW, Chen SY. Characterization of anti-cyclin E single-chain Fv antibodies and intrabodies in breast cancer cells: enhanced intracellular stability of novel sFv-F(c) intrabodies. J Immunol Methods. 2002;263(1-2):149-167. doi:10.1016s0022-1759(02)00035-2
| None |