Part:BBa_K3930001
β-ionone induction system and expression in S. cerevisiae (pFRAMBOISE-fused) Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 7298
Illegal SpeI site found at 7208
Illegal PstI site found at 7201 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 7298
Illegal NheI site found at 4342
Illegal SpeI site found at 7208
Illegal PstI site found at 7201 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 7298
Illegal BglII site found at 3135
Illegal BglII site found at 3318
Illegal BamHI site found at 753
Illegal BamHI site found at 3483
Illegal XhoI site found at 710
Illegal XhoI site found at 7605 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 7298
Illegal SpeI site found at 7208
Illegal PstI site found at 7201 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 7298
Illegal SpeI site found at 7208
Illegal PstI site found at 7201
Illegal NgoMIV site found at 6797 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 6646
Illegal SapI.rc site found at 6856
Introduction
The pFRAMBOISE-fused part (BBa_K3930001) enables the production of β-ionone from lycopene and is composed of:
- up (BBa_K3930012) and down (BBa_K3930013) integration sites in the X-3 locus (Chr X: 223616..224744) of the S. cerevisiae genome (based on the plasmid pCfB3032 from Easyclone Marker free kit (Jessop-Fabre et al.,2016)).
- the CrtY-phCCD1 fusion (BBa_K3930016), which allows the production of β-ionone. The sequence was codon optimized for an expression into S. cerevisiae.
- the expression block for rtTA-advanced activator of the promoter TetO7 (BBa_K3930019).
- the doxycycline inducible promoter (BBa_K3930014), driving the expression of the CrtY-phCCD1 enzymatic fusion.
- the resistance marker neoR (BBa_K3930020) to select yeast integrants.
Construction
IDT performed the DNA synthesis and delivered the part as gBlock. The construct was cloned with the In-Fusion Takara kit into the pCfB3032 plasmid and then transformed into E.coli Dh5α strain. Figure 1 shows the restriction map of a correct resulting clone.
pFRAMBOISE-fused insert was then linearized with the pFRAMBOISE_pCfB3032_Forward and pFRAMBOISE_pCfB3032_Reverse linearization primers. Then, the amplicon was integrated into the genome of our LycoYeast strain with the Takara Yeast transformation protocol. Figure 2 shows the electrophoresis gel of colony PCR to verify integrants genotype. The expected size was obtained for clone B1.
Primer used to clone this part in the pCfB3032:
- pFRAMBOISE_pCfB3032_Forward : 5' acaggcaatactctgcag 3'
- pFRAMBOISE_pCfB3032_Reverse : 5' tctctagaaagtataggaacttcac 3'
pFRAMBOISE-fused integration from clone B1 was checked by PCR visualised on EtBr stained agarose electrophoresis gel. A theoretical gel is presented on the right and the NEB 1 kb DNA ladder on the left (note that a different ladder is presented on the theoretical gel).
pFRAMBOISE-fused insert integration insertion at locus X-3 was successful. The integrant strain was named LycoYeast-pFRAMBOISE-fused and saved as a glycerol stock.
Characterization
Production of β-carotene
After verifying the correct integration of our construction by PCR, our engineered LycoYeast strain was placed on YPD plates containing the doxycycline inducer with the aim to detect color changes due to the conversion of lycopene (red) to carotene (orange) by CrtY.
Figure 3 shows the colors of the colonies with or without the inducer, the doxycycline. The LycoYeast-pFRAMBOISE-fused strain plated on a YPD with doxycycline shows a yellow coloration, indicating the degradation of lycopene into β-carotene. Moreover, a sweet smell of violet could be detected from the Petri plate.
The carotenoids contained in the cells were extracted using the method described by López et al. (2020). Yeast cells were lysed in acetone using glass beads and the supernatant obtained after lysis was analyzed by RP-HPLC on a C18 column. Figure 4 shows that lycopene is converted into a new product with a higher retention time upon induction. Considering the yellow color of the pFRAMBOISE-fused strain, this new peak most likely corresponds to β-carotene, the expected precursor.
Nevertheless, it does not seem that the TetO7 promoter is negatively regulated, as beta-carotene peak is observed even without induction with doxycycline.
Conclusion and Perspectives
These results show that pFRAMBOISE-fused may produce β-carotene thanks to the enzymatic fusion CrtY-phCCD1, indicating that the CrtY part of the construction is functional. It remains to be verified that this part can produce β-ionone thanks to the phCCD1 part of the fusion, and to quantify the β-ionone under the optimal conditions.
The β-ionone belongs to the terpenes family and may have other uses besides perfumery, notably in medicine. We sincerely thank the future teams that will use this construction and encourage them to contact us for further details.
References
- Chen X, Shukal S, Zhang C. 2019. Integrating Enzyme and Metabolic Engineering Tools for Enhanced α-Ionone Production. J Agric Food Chem. 67(49):13451–13459. doi:10.1021/acs.jafc.9b00860.
- Jessop-Fabre MM, Jakočiūnas T, Stovicek V, Dai Z, Jensen MK, Keasling JD, Borodina I. 2016. EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 11(8):1110–1117. doi:10.1002/biot.201600147.
- López J, Bustos D, Camilo C, Arenas N, Saa PA, Agosin E. 2020. Engineering Saccharomyces cerevisiae for the Overproduction of β-Ionone and Its Precursor β-Carotene. Front Bioeng Biotechnol. 8:578793. doi:10.3389/fbioe.2020.578793.
| None |