Part:BBa_K3813016
Her-2(Her-2) with optimized TA promoter and T1 terminator
Part Info
This part can be used to initiate the production of the HER-2 biomarker(protein) in an E.Coli cell system. HER-2 is an essential biomarker that is beneficial towards the detection of breast cancer. We decided to synthesize HER-2 in E.Coli in order to model biomarkers in human breast tissue and apply this for our aptamer experiments.
Construct Design
This is a composite part made up of a combination of previously existing parts from the iGEM registry: optimized (TA) repeat constitutive promoter(BBa_K137085) and T1 terminator(BBa_B0010), RBS along with the HER-2 gene sequence from NCBI.
Results
We selected the forward and reverse primers for our HER-2 protein sequence.
HER-2 Forward primer CAACCAAGTGAGGCAGGTCC Reverse primer GGTCTCCATTGTCTAGCACGG
We first used PCR to amplify our protein-coding sequence(found on NCBI) and selected our forward and reverse primers based on an extensive literature review we performed.
We then used Gibson Assembly to construct our part in the iGEM chloramphenicol backbone pSB1C3, before transforming it into E.Coli cells. We used a GFP reporter in our construct to monitor if the HER-2 sequence was successfully expressed in our E.Coli cells. Following transformation, we first qualitatively analyzed the plates to see if they were glowing. Since our construct was tagged with GFP, if the biomarker was successfully produced, then our colonies would glow.
Our qualitative analysis observed that there were glowing colonies on all parts of the plate, with relatively large colonies.
Figure 1: Transformation Results for BBa K3813016. The glowing colonies seen in the picture represent that HER-2 was successfully expressed in the system and that we could quantitatively analyze for the amount of protein produced through purification.
Protein Expression and Purification
To further verify our findings, we purified the HER-2 that was produced through transformation by applying freezing/cracking before using the regular purification process. This was because the HER-2 sequence was relatively large and without a tag, it was difficult to extract the protein out through regular purification. PAGE electrophoresis and readings from the 96-well plate reader indicated the presence of HER-2 from this construct.
Analysis of Protein Concentration
To calculate the concentrations of the biomarkers within each well, we first ran the BSA model to create the standard curve, where the x-axis represents absorbance, and y-axis represents the concentration in mg/ml. The standard curve later allowed us to convert the measured absorbance into measurements of concentration. The equation and the image of the standard graph we derived from the BSA model is as follows.
Figure 2: Standard Curve for BSA
Using the standard curve and the measured absorbance, we interpolated values of concentration for each of the different constructs. We performed this conversion by substituting the absorbance values into the x-variable in our standard curve, to find the corresponding y-variable which represents concentration. The post-conversion concentrations of the biomarkers are listed below.
For construct BBa_K3813016, we had a reading of 0.36 mg/ml for the concentration of biomarker synthesized.
References
[1] Wang, Y., Kirpich, I., Liu, Y., Ma, Z., Barve, S., McClain, C. J., & Feng, W. (2011). Lactobacillus rhamnosus GG treatment potentiates intestinal hypoxia-inducible factor, promotes intestinal integrity and ameliorates alcohol-induced liver injury. The American Journal of Pathology, 179(6), 2866–2875.
[2]Homo sapiens chromosome 1, GRCh38.p13 Primary Assembly - Nucleotide - NCBI. (n.d.). Retrieved August 2, 2021, from https://www.ncbi.nlm.nih.gov/nuccore/NC_000001.11?report=fasta&from=155185824&to=155192915&strand=true
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 26
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 21287
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
None |