Part:BBa_K3629015

Nourseothricin resistance expression construct with gibson homology sequences

Usage and Biology

This is the expression construct for nourseothricin resistance, which is a robust selection marker that can be used in many eukaryotes, specifically yeast, including Yarrowia lipolytica -the chassis for our project. Particularly for Y. lipolytica there are not many available auxotrophy-based selection markers due to the limited number of auxotrophic strains publically available for use. Therefore, antibiotic resistance genes are a suitable alternative. To use this selection marker, 50-200µg/mL is added to media depending on the organism.

The part is a key part of our collection and functions as a destination vector for other Y. lipolytica parts when cloned into a plasmid.

Design

Table 1. This table presents the restriction enzymes that can be used to digest this expression construct and expose the ends of the built-in Gibson homology sequences to T5 exonuclease. T5 exonuclease requires a blunt end or sticky end at the 5’ end to start degrading a DNA strand from 5’ to 3’.

GIBSON ASSEMBLY

This expression construct was designed to be assembled with other expression constructs from our collection via Gibson Assembly:

• BBa_K3629013= Modified P. funiculosum CBHI expression construct
• BBa_K3629014= N. crassa CBHI expression construct
• BBa_K3629012= TrCBHII expression construct
• BBa_K3629016= Modified T. reesei EGI expression construct
• BBa_K3629017= T. reesei EGII expression construct
• BBa_K3629018= N. patriciarum BGS expression construct

To use this part in the various Gibson assemblies, it must first be digested by SmaI to expose the ends of the Gibson 1 and 2 homology sequences for T5 exonuclease (table 1). Parts that are being inserted into this destination vector must also be designed and digested accordingly to expose the Gibson 1 and 2 homology sites. Following assembly, the newly formed gene cassette can be linearized with NotI and transformed into Y. lipolytica (figure 1). This is done because Y. lipolytica prefers to integrate linear DNA fragments through non-homologous end joining over plasmid maintenance. To watch a short animation on how this Gibson Assembly system works click here.

Figure 1. Assembly of multiple expression constructs into one gene cassette using the nourseothricin resistance construct (BBa_K3269015) as the destination vector.

If the genomic homology regions are long enough (≥1kb), then homologous recombination may occur, particularly in <Y. lipolytica </i> strains with Zeta docking sequences. Therefore, to enable the addition of genomic homology regions, the sequences Gibson A/B and Gibson C/D were added to this construct. Upon digestion with HpaI and exposure to T5 exonuclease the Gibson A/B sequences can be used to add a genomic homology region upstream of the insert coding sequence, whereas the Gibson C/D sequences can be used to add a genomic homology region downstream of the insert coding sequence.

The expression constructs mentioned above were designed to be assembled together in different combinations. Over 20 different gene cassettes can be formed using these parts, all using this Nourseothricin expression construct as a destination vector. The full tables outlining the assembly of these different cassettes can be found here.

CONSTRUCT COMPONENTS

1. Nourseothricin resistance coding sequence (BBa_K3629011)
2. TEF promoter (BBa_K2117000) for high expression
3. gPCR primer binding sequences to determine where the gene cassette inserted in the Y. lipolytica genome
   • Upstream primer: 5' GCAGAGACTTAACATTAGCAAGC 3'
   • Downstream primer: 5' GGTGATTGACTGATGTGAATCC 5'
4. XRP2 terminator was used for its short and compact sequence

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal prefix found in sequence at 1
  Illegal suffix found in sequence at 1590
  Illegal EcoRI site found at 1449
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal EcoRI site found at 1
  Illegal EcoRI site found at 1449
  Illegal NheI site found at 1584
  Illegal SpeI site found at 1591
  Illegal PstI site found at 1605
  Illegal NotI site found at 7
  Illegal NotI site found at 1598
  
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal EcoRI site found at 1
  Illegal EcoRI site found at 1449
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal prefix found in sequence at 1
  Illegal suffix found in sequence at 1591
  Illegal EcoRI site found at 1449
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal prefix found in sequence at 1
  Illegal EcoRI site found at 1449
  Illegal XbaI site found at 16
  Illegal SpeI site found at 1591
  Illegal PstI site found at 1605
  
• 1000
  COMPATIBLE WITH RFC[1000]

There is an EcoRI site within the XRP2 terminator making this part RFC10 incompatible. However, we added the BioBrick prefix and suffix so that the other enzymes (NotI, XbaI, SpeI, and PstI) could be used to clone this part into an iGEM plasmid or another plasmid. This part can also be cloned through RFC1000 assembly.