Part:BBa_K3407025

pKDsgRNA_4.3 sgRNA targetting phage T7 gene 4.3

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
COMPATIBLE WITH RFC[1000]

Usage and Biology

One of the methods that can be used to engineer bacteriophages is Bacteriophage Recombineering of Electroporated DNA (BRED). As the first product of BRED results in a mixture of wild-type and engineered phages, a CRISPR/Cas9 system can be designed to speed up the selection process for the engineered phage. [1] CRISPR Cas9 is a gene engineering system based on the native CRISPR Cas system of Streptococcus pyogenes. The CRISPR/Cas9 gene engineering system consists of a sgRNA guided Cas9 nuclease and makes double-strand break at a particular sequence. The double-strand break will be repaired by the lambda red system for recombineering. The target sequence (protospacer) is a sequence of 20 nucleotides that must precede a PAM sequence (NGG). [2]

This basic part encodes for single-guide RNA (sgRNA) that targets a protospacer in gene 4.3 of the wildtype T7 phage. The protospacer sequence is 5’ tgcatccactaaagttaccgagg 3’, with the PAM sequence annotated in bold. The designed sgRNA has been cloned in the commercial plasmid backbone pKDsgRNA-p15 (BBa_K3407025), a plasmid that contains an arabinose inducible lambda red system for recombineering and anhydrotetracycline inducible sgRNA expression. Guided by this sgRNA, Cas9 binds to the target sequence and makes a double stranded break at this certain position, resulting in the cleavage of the T7 wild-type phage DNA. Therefore, this system can be used to select for the engineered phage after replacing gene 4.3 as described by Kiro et al [1]. .

Experimental results

To engineer a phage to encode for a desired molecule, we first investigated whether we could successfully engineer bacteriophages by replacing non-essential genes. We identified the three non-essential T7 genes as possible candidates: 0.6A (early gene), 1.1 (early gene) and 4.3 (middle gene) [3]. In order to determine which of these genes should be substituted with our recombinant gene, we performed proof of concept experiments using enhanced GFP del6(229) (eGFP) as a reporter, substituting each of the target T7 non-essential genes separately.

The non-essential genes were replaced by a double-stranded DNA (dsDNA) construct, coding for enhanced GFP, through Bacteriophage Recombineering of Electroporated DNA (BRED), designed by Marinelli et al. [4]. This construct was designed with 100 nt homologous to flanking regions on each side of these aforementioned non-essential genes.

Confirmation of gene replacement

The phage samples obtained after BRED were screened by PCR for the presence of the insert, using both internal and external primers (Figure 1A). The external PCR products of the BRED samples were of the same size as the product from the wildtype phage, indicating that the wild-type phages were still abundant in the phage samples after BRED . The internal PCR products did show amplification of DNA at each position, because the internal primer only anneals to GFP, therefore showing that there were engineered phages present in each sample after BRED. A second band was shown at position 0.6 and 1.1 of unexpected size. Due to these results, it was decided to continue working with the sample containing T7 engineered at position 4.3.(Figure 1,B).

To select for the engineered phage, the BRED sample was plated on E. coli BL21 (DE3) with an induced CRISPR/Cas9 system targeting the wild-type gene 4.3 expecting a higher concentration of the engineered phage in the resulting plaques. This transformed host bacteria contained the pKDsgRNA_4.3 plasmid containing the sgRNA targeting the T7 gene 4.3 (BBa_K3407025), as well as the Cas9 plasmid pCas9-CR4 <a href=”#reference” class=”jump”>[5]</a>. Plaques were screened with primer binding inside the eGFP gene (internal primers,I), resulting in one positive plaque (Figure 1C, line 4). The positive plaque was replated on E. coli BL21 (DE3) with an induced CRISPR/Cas9 system targeting the wild-type gene 4.3 and picked, as well as lysed for screening with primer binding inside the eGFP gene (internal primers,I) (Figure 2,D). Amplification of most plaques with those primers showed DNA bands, however, not at the expected size of 727 bp, but around 300 bp (Figure 1,D). Some of the positive plaques obtained were screened for the presence of wild-type T7 phage by using both external and internal primers (Figure 1, E). This amplification showed high concentrations of amplified DNA of approximately 600 bp, the expected size for the wild type phage. This indicates that the secondary plaques still contained high concentration of the wild type phage. We were not able to confirm the presence of the eGFP by sequencing.

Figure 1: T7 bacteriophage engineering replacing gene 4.3 by eGFP using BRED. A) Representation of the amplification of the engineered region of T7 with external primers marked as E, and one internal and one external primer marked as I. B) PCR screening of BRED samples for replacement of non-essential genes 0.6, 1.1 and 4.3 (lanes 2 through 7) using internal and external primers. Lane 8 (wt) shows amplification of the entire lysate of T7 wild-type obtained after electroporation without the addition of dsDNA substrate. C) PCR Screening of primary plaques obtained after plating the sample of BRED on E.coli expressing a Cas9 system targeting gene 4.3 using internal primers. D) PCR Screening of secondary plaques and secondary lysate (P) with internal primers. E) PCR Screening of secondary plaques with both internal and external primers. Each gel consisted of 1% agarose, the DNA ladder used is the Smartladder (Eurogentec).

Conclusion BRED was performed to replace non-essential genes 0.6, 1.1 and 4.3 of the wild type T7 phage by eGFP, successfully obtaining positive engineered phages in each of the positions after screening by PCR. T7 phages engineered in the 4.3 gene position were replated further in order to obtain isolated engineered phages, as the wild type phage was still present in the samples. Further PCR screening should be done to isolate the T7 phage engineered at position 4.3, using the constructed E. coli BL21 (DE3) host strain containing the CRISPR/Cas9 system targeting the 4.3 gene of the wild-type T7 phage.

References

Ordered List