Part:BBa_K2946014

TS12

Part two of a logic AND gate circuit based on trans - splicing events (TS). This reaction designed to take place between the transcripts of two exogenously introduced modules. Similarly to TS2(BBa_K2946011) the expression is driven by the H2A1p promoter .The promoter sequence is followed by the 40bp linker of the kanamycin resistance gene (positions 421-460). The TS binding domain (BD) in module TS12 is the reverse complementary of the AFP-based TS guiding sequence of module TS11, with the 2 nucleotide mismatch (marked):

5’TTGATCCTTTCTCCAAATCTCTTCTTTTAAATTAAATCCAAATCTCTCCA 3’

This TS guiding sequence is followed by the 34bp linker which precedes the HSV1pA poly A (Figure 1) and the intron splice enhancer, branch point, polypyrimidine tract and the acceptor splice site, all taken from (8), continuing with mKate2 exon 2, 40bp linker (positions 361-400 in the kanamycin resistance gene) and the HSV1pA poly A site.

This pre-mRNA designed to attach to another synthetic pre-mRNA (module TS11) if present in order to create a full mRNA of our gene of interest (GOI - MKate2) by trans splicing. By itself it will not form a transcriptable RNA code and will not produce protein

In this system, the output protein is expressed only when the promoters regulating both modules are mutually active. However, when only one of the promoters is active or when none of the promoters are active, they cannot produce any functional protein. thus, standing alone, is permanently in state ‘0’.

We defined two different states for this circuit: in state [1,0], module 1 is active, while module 2 is inactive (off); and in state [1,1], both module 1 and module 2 are active (on).

Results

Expression in HEK293T cells - the data below display the transient transfection of HEK293T cells with plasmids containing LoGENEgate by flow cytometry. Any expression below the negative control (<3.09%) is irrelevant, hence amounts to 0% expression of GOI. As expected in [1,0] states there is no product, 0% expression Fig 2 – TS12 compared to control, TS11 and TS11+TS12 experiments.