Part:BBa_K2643003
Glycine Helical peptide Linker (GHL
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 2
Illegal NgoMIV site found at 27 - 1000COMPATIBLE WITH RFC[1000]
Usage and Biology
To fuse the Tn5 transposase (BBa_K2643002) and the dxCas9 BBa_K2643001, a Glycine Helical peptide Linker was used. The flexible linker is composed of 18 amino acids (K L G G G A P A V G G G P K A A D K) [1]. The GHP linker was selected as a high potential candidate due to its success linkage of transposase with other proteins for example to fuse piggyback transposase with ERT2, a ligand-binding domain, [1] or to fuse sleeping beauty transpose with zinc finger DNA-binding domain [2].
Characterization
Introduction
The linker biobrick was characterized together with dxcas9-tn5 fusion protein, demonstrating that this peptide does not interfere with the activity of either protein domains. For the documentation of the expression, purification, and functionality, see the dxCas9-Tn5 documentation BBa_K2643000. Construction of the linker is the only characterization covered in this document.
Strain construction
Aim
The construction of the Glyine-Helical-peptide-Linker in the iGEM compatible pSB1C3 BioBrick backbone was performed by Gibson assembly cloning of the Glyine-Helical-peptide-Linker into the iGEM pSB1C3 backbone.
Construction of the Glyine-Helical-peptide-Linker into pSB1C3
Plasmid BBa_J04450 from the iGEM registry was used as template for obtaining the linear pSB1C3 iGEM BioBrick Backbone. This BioBrick contains a mRFP expression cassette that turns cells harbouring the plasmid red. BBa_J04450 was transformed into chemically competent E.coli DH5α cells. Red colonies were grown in LB + chloramphenicol and the plasmid was isolated. The plasmid BBa_J04450 was used to obtain the iGEM BioBrick backbone pSB1C3 by PCR using forward primer (5’-TACTAGTAGCGGCCGCTGC-3’) and reverse primer (5’-CTAGAAGCGGCCGCGA-3’). The primers amplify the iGEM pSB1C3 BioBrick backbone from the suffix until the prefix.
The Glyine-Helical-peptide-Linker was constructed with the use of forward primer (5’- CGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGGGCCGGCCtAAACTGG-3’) and reverse primer (5’- CTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATTTATCCGCCGCTTTCGGGCCGCCGC -3’). A recommendation for easier use of the linker, is to use different primers, which contains both prefix and suffix.
The pSB1C3 backbone and the Glycine-Helical-peptide-Linker were combined by Gibson assembly. Subsequently, the Gibson assembly product was transformed into chemical competent E. coli DH5α cells using heat shock via the [http://2018.igem.org/Team:TUDelft/Experiments#chemcomptcellstrans-scroll chemical competent cell transformation protocol]. The transformation resulted in white colonies, indicating that an insert is integrated, other than mRFP. The parental plasmid is not present anymore.
Results
Ten colonies were screened via colony PCR using forward primer VF2 (5’-tgccacctgacgtctaagaa-3’) and reverse primer VR (5’-attaccgcctttgagtgagc-3’) that amplify the DNA from the before the prefix until after the suffix. This way, any fragment cloned between the prefix and suffix would be amplified.
The small differences between the bands were hard to distinguish (figure 1, lane 3-8, 10). Possibly colony 4 and 7 contained the insert of the linker (figure 1, lane 5 and 8).
Figure 1. Colony PCR of linker, expected size 376bp. 0.8% Agarose. The ladder represents the size of DNA in bps.
A second round of screening is preformed with forward primer (5’- CGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGGGCCGGCCtAAACTGG-3’) and reverse primer (5’- CTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATTTATCCGCCGCTTTCGGGCCGCCGC -3’) that amplify the linker. This way, the linker is amplified. The colony PCR reactions resulted in one possible colony with correct integration of the Glyine-Helical-peptide-Linker in pSB1C3 (figure 2, lane 2).
Figure 2. Colony PCR of linker, expected size 105bp. 2% Agarose. The ladder represents the size of DNA in bps.
Glycerol stocks of the cells harbouring the pSB1C3_Tn5 plasmid were stored at -80ºC and the plasmid was sent to the iGEM registry.
Summary
The linker biobrick was characterized together with dxcas9-tn5 fusion protein, demonstrating that this peptide does not interfere with the activity of either protein domains. For the documentation of the expression, purification, and functionality, see the dxCas9-Tn5 documentation BBa_K2643000. Construction of the linker was the only characterization covered in this document.
Source
The peptide linker used to fuse dxCas9 with Tn5 is described by Voigt et al. (2012) [2]. This linker is based on a previous described linker used for the fusion of piggyBac transposase to the modified ligand-binding domain of oestrogen receptor ERT2 [1]. The peptide sequence is manually converted to a DNA sequence. The linker sequence is ordered at Integrated DNA Technologies (IDT) as primers, used as template for amplification.
Safety
This part can be used in ML1 level biosafety laboratory.
References
- ↑ 1.0 1.1 1.2 Cadinanos, J., & Bradley, A. (2007). Generation of an inducible and optimized piggyBac transposon system. Nucleic acids research, 35(12), e87.
- ↑ 2.0 2.1 Voigt, K., Gogol-Döring, A., Miskey, C., Chen, W., Cathomen, T., Izsvák, Z., & Ivics, Z. (2012). Retargeting Sleeping Beauty Transposon Insertions by Engineered Zinc Finger DNA-binding Domains. Molecular Therapy, 20(10), 1852-1862. doi:10.1038/mt.2012.126
| None |