Part:BBa_K2571006
Dual Expression of FucO and GSH
Usage and Biology
The first protein coding region we have, placed after the RBS, FucO, will code for L-1,2-propanediol oxidoreductase (a homodimer enzyme) in order to act upon furfural presence in the field (Zheng, 2013). The metabolism of furfural by NAD(P)H-dependent oxidoreductases will reduce the toxicity of the chemical by turning it into furfuryl alcohol, a derivative and increase the furfural tolerance (Zheng, 2013; Wang et al., 2013; Allen et al., 2010). Our second protein coding region, bifunctional gamma-glutamate-cysteine ligase/glutathione synthetase (GSH), is a non-protein thiol group and a tripeptide composed of cysteine, glycine and glutamic acid (Lu, 2013). It is crucial for the detoxification of reactive oxygen species and free radicals (Ask et al, 2013). Reactive oxygen species (ROS) are harmful substances that alter protein based matters by taking electrons (Lu, 2013; Burton & Jauniaux, 2011). Because many benefits of GSH include scavenging of ROS, protection against endogenous toxic metabolites and detoxification of xenobiotics, we choose this gene to entagrate with the FucO (Höck et al., 2013). Thus we constructed multi functional gene providing long life span and resistance.
Design Notes of Dual Expression of FucO and GSH (BBa_K2571006)
Our construct for composite part 3 is composed of two stages, first the reduction of furans (specifically furfural and 5-HMF) and second the detoxification of reactive oxygen species (ROS). To achieve this effect, we designed our composite 3 part as with a prefix, a strong promoter (J23100), RBS (B0034), fucO as the first protein coding region (BBa_K2571003), RBS (B0034), GSH as the second protein coding region(BBa_K2571005) , double terminator (B0015) and suffix.
Our construct is inserted into pSB1C3 and delivered to the Registry. Our construct is also inserted into pSB1A3 and transferred into KO11 to conduct further biochemical assays.
Given that fucO is NADH-dependent it outperforms other oxidoreductases, by not interfering with the NADPH metabolism of the organism while converting highly toxic substances, furfural and 5-HMF to non-harmful alcohols. This characteristic of fucO is crucial because the expression of oxidoreductases like Yqhd are NADPH-dependent, hence they compete with the biosynthesis for NADPH, which results in inhibiting the growth of the organism.
Glutathione, on the other hand, is recycled using NAD(P)H pathways and since now it will be overexpressed and with NADH metabolism is not being altered thanks to FucO, antioxidant capacity of the cell will be increased dramatically, result in amplified immunity to both furans and ROS, habilitating cell growth, increasing ethanol yield by the virtue of increasing cell mass and reproduction, and improved metabolism.
Characterization
Allergen Characterization:
Our parts can be used in ethanol production and we used it in the lab for mass production, it was important to construct an allergenicity test. The allergenicity test makes a comparison between the sequences of the biobrick parts and the identified allergen proteins in the database. If the similarity between the biobricks and the proteins is high, it is more likely that the biobrick is allergenic. In the sliding window of 80 amino acid segments, greater than 35% means similarity to allergens. Higher similarity implies that the biobricks have a potential for negative effect to exposed populations. For more information on the protocol see the “Allergenicity Testing Protocol” in the following page http://2017.igem.org/Team:Baltimore_Bio-Crew/Experiments
Our biobrick part, BBa_K2571006 showed less than 35% match in the 80 amino acid alignments by FASTA.
Gel Characterization:
We’ve inserted our composite part 3(BBa_K2571006) in both pSB1C3 and pSB1A3 backbones. The construct in pSB1C3 is for submission to registry and is cultivated in DH5 alpha. The plasmid having pSB1A3 as backbone, thus carrying ampicillin resistance is for our biochemical assays since we’ve chosen the chassis organism for assays as E.coli strain KO11 which already has Chloramphenicol resistance in its genome. After cloning our genes, we’ve made colony PCR to verify our insertions. We chose the primers as FucO specific since the composite 3 contains FucO coding region. Expected band length was 194 bp, and as expected, the bands were given by all of the DH5 alpha and KO11 colonies we chose, confirming our transformations.
FucO specific primers were used:
FucO left: GTGATAAGGATGCCGGAGAA
FucO right: CTTCTCGCCGGTAAAGTCAG
Biochemical Characterization:
We designed our biochemical characterization experiments in order to evaluate the effects of our circuits on life span, cell mass, and ultimately the bioethanol yield of ethanologenic E. coli strain KO11. We carried out two experimental assays simultaneously.
In both of our biochemical assays, we had four cultured groups of KO11 ethanologenic strains of E.coli to test.
1. KO11 un-engineered,
2. KO11 with only FucO,
3. KO11 with only GSH,
4. KO11 with Bio-E (both FucO and GSH).
First Assay:
Throughout our first assay, each group was grown in LB broth mediums containing 2% glucose and antibiotics.
To culture group #1 (KO11 un-engineered), we only added Chloramphenicol at a final concentration of 40 µg/mL since KO11 un-engineered only had resistance to Chloramphenicol in its genome; and to the mediums of the groups numbered 2, 3 and 4; we added Chloramphenicol at a final concentration of 40 µg/ml and 100 µg/ml Ampicillin. The reason was; groups 2, 3 and 4 had plasmids which carried Ampicillin resistance due to their backbone (pSB1A3). Thus, with the addition of antibiotics to the mediums, selectivity was assured.
Cultures were grown overnight, and refreshed in the morning as two sets (First set: 10 mM furfural, 2nd set: 20 mM furfural). After approximately two hours of incubation for both of the sets’ falcon groups (when they reached OD 0,6), furfural was added to their mediums.
First Set (10 mM furfural):
We added furfural at a final concentration of 10 mM to the first four test groups’ mediums and took OD measurements at Abs 600 nm with 1/10 dilution in 24 hour time intervals.
10 mM furfural OD measurements: Abs 600 nm (1/10 dilution):
Analysis of data:
Our data demonstrated that group #1 (un-engineered) had a decrease in cell mass throughout the time verifying the inhibition of cell growth in the presence of furfural in the field. Group #2 (KO11 with only FucO) obviously gave better results with respect to un-engineered KO11. However, although the cell mass of the KO11 group with only FucO was stable in the first 48 hours, it was decreased after the 48th hour. This proves that only the presence of the gene FucO in the bacteria wasn’t enough to avoid cell mass decrease in the long term and is in need of another gene for increased tolerance. Also, only GSH’s presence isn’t enough since the group of KO11 with only GSH experienced decrease in cell mass. Group #4 (KO11 with Bio-E (both FucO and GSH)) gave measurement results as we hypothesized by continuing cellular growth in the first 48 hours and maintaining it even after the 48th hour, though at a lower rate.
Second Set (20 mM furfural):
To gather more information to prove our hypothesis, we designed our second experimental set and added furfural at a final concentration of 20 mM to the four test groups’ mediums followed by OD measurements at Abs 600 nm with 1/10 dilution in 24 hour time intervals.
20 mM furfural OD measurements: Abs 600 (1/10 dilution):
For our second set, we could only obtain the measurements of the first 48 hours since we faced contamination in the last day of wet-lab and we had no more time. Thus, we modelled our second experimental set’s results by demonstrating the comparison of OD results at absorbance 600.
Analysis of Data:
Our data demonstrated that group #1 (KO11 un-engineered) had a decrease in cell mass as time passed. Group #2 (KO11 with only FucO) also experienced a decrease in cell mass. Group #3 (KO11 with only GSH) gave better results with respect to both of the groups #1 and #2 by maintaining its cell mass stable. Group #4 (KO11 with Bio-E (both FucO and GSH)) gave the most promising measurement data as we hypothesized by continuing cellular growth (almost doubling cell mass) in the first 48 hours.
Second Assay:
For our second characterization, we followed more of qualitative evaluation to see the inhibitory zone of furfural. Firstly, we prepared a solution of furfural at a final concentration of 20 mM by diluting the stock solution with distilled H2O. Then, we soaked filter paper discs in that solution and placed them on LB agar plates hosting the four groups of our assay.
After 48 hours, we’ve observed a clear zone around the filter paper of the group containing KO11 un-engineered while others weren’t inhibited as much.
Conclusion:
When the quantitative measurement data and qualitative phenotypic evaluation for all of our biochemical assays are considered, we can conclude that the groups containing KO11 un-engineered are the weakest ones against furfural toxicity; and neither the group of KO11 with only FucO nor the group with only GSH is resistant enough to continue cellular growth when furfural is present in the medium. Out of four groups, only the group containing KO11 with Bio-E (both FucO and GSH) can sustain its cellular growth and survive. Overall, we can infer that our best part design (Bio-E) was successful enough to combat the inhibitive effects of furfural, indicating trueness of our hypothesis.
References
Allen, S. A., Clark, W., McCaffery, J. M., Cai, Z., Lanctot, A., Slininger, P. J., … Gorsich, S. W. (2010). Furfural induces reactive oxygen species accumulation and cellular damage in Saccharomyces cerevisiae. Biotechnology for Biofuels, 3, 2. http://doi.org/10.1186/1754-6834-3-2
Ask, M., Mapelli, V., Höck, H., Olsson, L., Bettiga, M. (2013) Engineering glutathione biosynthesis of Saccharomyces cerevisiae increases robustness to inhibitors in pretreated lignocellulosic materials. Microbial Cell Factories. 12:87 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3817835/
Burton, G. J., & Jauniaux, E. (2011). Oxidative stress. Best Practice & Research. Clinical Obstetrics & Gynaecology, 25(3), 287–299. http://doi.org/10.1016/j.bpobgyn.2010.10.016
Chou, H.-H., Marx, C. J., & Sauer, U. (2015). Transhydrogenase Promotes the Robustness and Evolvability of E. coli Deficient in NADPH Production. PLoS Genetics, 11(2), e1005007. http://doi.org/10.1371/journal.pgen.1005007
Liu, Z.L., Ma M., Song, M.(2009). Evolutionarily engineered ethanologenic yeast detoxifies lignocellulosic biomass conversion inhibitors by reprogrammed pathways. Mol Genet Genomics 282, 233-244. doi: 10.1007/s00438-009-0461-7
Lu, S. C. (2013). GLUTATHIONE SYNTHESIS. Biochemica et Biophysica Acta, 1830(5), 3143–3153. http://doi.org/10.1016/j.bbagen.2012.09.008
National Center for Biotechnology Information. PubChem Compound Database; CID=124886, https://pubchem.ncbi.nlm.nih.gov/compound/124886 (accessed July 18, 2018). https://pubchem.ncbi.nlm.nih.gov/compound/124886#section=Top
Patrick, L. (2003). Mercury Toxicity and Antioxidants: Part I: Role of Glutathione and alpha-Lipoic Acid in the Treatment of Mercury Toxicity. Alternative medicine review: a journal of clinical therapeutic.(7). 456-471. https://www.researchgate.net/publication/10980025_Mercury_Toxicity_and_Antioxidants_Part_I_Role_of_Glutathione_and_alpha-Lipoic_Acid_in_the_Treatment_of_Mercury_Toxicity
Pizzorno, J. (2014). Glutathione! Integrative Medicine: A Clinician’s Journal, 13(1), 8–12. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684116/
Wang, X., Miller, E. N., Yomano, L. P., Zhang, X., Shanmugam, K. T., & Ingram, L. O. (2011). Increased Furfural Tolerance Due to Overexpression of NADH-Dependent Oxidoreductase FucO in Escherichia coli Strains Engineered for the Production of Ethanol and Lactate. Applied and Environmental Microbiology, 77(15), 5132–5140. http://doi.org/10.1128/AEM.05008-11
Wang, X., Yomano, L. P., Lee, J. Y., York, S. W., Zheng, H., Mullinnix, M. T., … Ingram, L. O. (2013). Engineering furfural tolerance in Escherichia coli improves the fermentation of lignocellulosic sugars into renewable chemicals. Proceedings of the National Academy of Sciences of the United States of America, 110(10), 4021–4026. http://doi.org/10.1073/pnas.1217958110
Zheng, H., Wang, X., Yomano, L.P., Geddes, R. D, Shanmugan, K. T., Ingram, L.O. (2013). Improving Escherichia coli FucO for Furfural Tolerance by Saturation Mutagenesis of Individual Amino Acid Positions. Applied and Environmental Microbiology Vol 79, no 10. 3202–3208. http://aem.asm.org/content/79/10/3202.full.pdf+html
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 3247
| None |