Composite

Part:BBa_K2323002

Designed by: Jorge Andres Quintero Serna   Group: iGEM17_Munich   (2017-10-25)


TEV protease with N-terminal 6x His-Tag under the control of the pT7 promoter

Introduction

TEV protease is a highly specific cysteine protease from the Tobacco Etch Virus. An improvement over BBa_K1319008, the protease can be expressed in strains with T7-polymerase and then purified with the help of the His-Tag for use in downstream synthetic in-vitro circuits or protein purification.

Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 71
    Illegal AgeI site found at 803
  • 1000
    COMPATIBLE WITH RFC[1000]

Usage and Biology

The Tobacco Etch Virus (TEV) protease is a cysteine protease with high specificity towards its target sequence. Along with two other proteins in the Tobacco Etch Virus, it has the function to cleave the polyprotein that is produced after translating the whole (+)-stran RNA genome of the virus. In addition, the natural TEV protease contains its own target sequence and thus cleaves itself, reducing its activity over time. For scientists, the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognises the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves it between glutamic acid and serine. This target sequence is uncommon in natural proteins, allowing the in-vivo expression and use of TEV protease without a toxic side-effect caused by unwanted cleavage of host proteins. To avoid the autolysis, TEV protease is usually used with a single S219V point mutation to make the cleavage site unrecognisable for the protein.


Plasmid composition

As with BBa_K1319008, our coding sequence is under the control of a T7 promoter (BBa_I719005 and flanked at the 3' side by a double terminator BBa_B0015. In addition to this, purification of the protein is possible thanks to the 6x His-tag (BBa_K128005) at the N-Terminus, right after the promoter and RBS.

The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promoter and RBS. (read-only benchling map)

Cloning, Expression and Purification

The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev, that had a 5'-phosphate modification.

Name 5'-3' primers sequences
p-TEV-His-fwd catcatcaccatcaccacgccggcggcgaaagc
p-TEV-His-rev catctagtatttctcctctttctctagtatctccc
Gel of the Overhang PCR

After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in E. coli DH5α for plasmid storage and E. coli BL21star for protein expression. For expression, cells were grown in 2xYT medium and then induced with 1 mM IPTG at the exponential phase. 3 h after induction, the protein was purified using a Ni-NTA-affinity column followed by size exclusion chromatography.


Affinity purification of His-TEV using the Äkta protein purification system.

The chromatogram of the protein purification using the Äkta system didn't showed a clear peak, but rather it was distributed along 20 ml of eluat, with a small peak around 24 ml. Although this would suggest impure protein or small yield, 10% SDS-PAGE gels suggests great quantities of TEV protease were purified, especially in fraction #10, which corresponds to the peak seen in the chromatogram. Moreover, even though some contamination with larger proteins was observed, this was more prominent in the first fractions and became smaller as the peak was reached.

Size exclusion chromatography of TEV protease

Fractions containing TEV protease were then pooled together and further purified with size-exclusion chromatography. Here, the peak in the chromatogram was more pronounced, as expected. In addition, we observed a small peak at the beginning of the chromatogram. This peak corresponded to the first fractions in the 10% SDS-PAGE gel, where the elution of large proteins was observed, probably of the same ones observed in the gel after affinity chromatography. Later fractions showed a higher protein concentration, with fraction #9 being the highest, even though some contamination was still present. After this fraction, the concentration of TEV protease quickly decreased. Fraction #10 had the purest protease, as no other bands were seen.

10% SDS-PAGE of size exclusion chromatography.

To prove that our TEV protease was functional with the 6x His-tag and could still be used for proteolysis, we did an activity assay: 1 μg of 6x His-tag protease was mixed in a solution containing 30 μg His-MBP-Cas13a-Lsh and then incubated at room temperature for 0, 1, 2 ,3 ,4 ,5 hours and overnight. The samples were inactivated by adding SDS-loading buffer to the working concentration. Aliquots were loaded on a 10% SDS-PAGE and the proteolysis was assessed.

TEV-protease activity assay

As seen on the gel, 6x His-Tag TEV protease conserves its activity and can still cleave target. Already one hour incubation time is sufficient to cleave protein. In fact, there was little to no difference observed between the incubation times after 1h of incubation. Although this lack of difference could be explained by some TEV protease still remaining active after addition of SDS-loading buffer, it is clear that, regardless of the purification tag, the protease still cleaves its target specifically and efficiently.


[edit]
Categories
Parameters
None