Part:BBa_K2155001

BFD---Carbon chain elongation

Usage and Biology

In enzymology, a benzoylformate decarboxylase (EC 4.1.1.7) is an enzyme that catalyzes the following chemical reaction:

benzoylformate + H+ ⇌ benzaldehyde + CO2

However, in our project we used an engineered benzoylformate decarboxylase, which could catalyze formaldehyde to synthesize Glycolaldehyde and Dihydroxyacetone(Figure1 and Figure2). If you use it to catalyze reaction in vivo, It needs one cofactor, thiamin diphosphate.

Figure 1. DHA and Glycoaldchyde could be synthesize from Formaldehyde by BFD.

Figure2. HPLC analysis of samples from in vitro experiment of BFD.

Figure3. BFD is fused with dockerin and then it bind with matching CtCohesin.

This year we fused BFD with CtDock, and then CtDock could bind with CtCohesin(Figure3), which is part of our scaffold protein. Therefore, our core enzyme could form a enzyme complex, and the catalytic efficiency could be greatly improved.

Expression, Purification and SDS-PAGE

Expression

The part was assembled with T7 promoter and RBS in pET28a plasmid vector for expression. E. coli strain BL21(DE3) harboring the appropriate plasmid was grown at 37 °C in 2xYT medium overnight with suitable concentration of antibiotic. When the culture was grown at 37°C to an optical density of 0.6~0.8 at 600 nm, the protein expression was induced with 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and cells were grown for 16h at 16°C.

Purification

Cells were centrifuged at 5500rpm for 15min at 4°C. Resuspend the cell paste expressing recombinant protein in binding buffer (20 mM Tris-HCl, 0.5 M NaCl, 20 mM imidazole, 1mM β-mercaptoethanol, pH7.4). Disrupt the cells with sonication for 20 min with suitable power on ice and centrifuge at 8000 rpm for 40 min at 4°C. Remove remaining particles by passing the supernatant through a 0.45μm filter. The HisTrap™ column (GE Healthcare, Inc.) was equilibrated with binding buffer. Load the sample and wash the column with binding buffer. Elute the target protein with a concentration gradient of imidazole starting with binding buffer including 50mM imidazole and ending with the same buffer including 300mM imidazole. The eluted fraction containing the target protein were concentrated by Column-PROTEIN-Concentrate™ with a 10 kDa cutoff.

SDS-PAGE

Protein purification was checked by SDS-PAGE and the resulting protein is quantified by Coomassie (Bradford) Protein Assay.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal NgoMIV site found at 759
  Illegal NgoMIV site found at 1221
  Illegal AgeI site found at 223
  
• 1000
  INCOMPATIBLE WITH RFC[1000]

  Illegal SapI site found at 130
  

Improvement by iGEM NPU-2018

This part has been improved by NPU-China.

Click here to get more information about Part: https://parts.igem.org/Part:BBa_K2707013

Improvement characterization

1. Activity assay and kinetic properties of BFD and mutants An initial continuous assay included 50 mM potassium phosphate buffer (pH 7.4), 5 mM MgSO4, 0.5 mM thiamine diphosphate, 50 μg/mL glycerol dehydrogenase, 0.8 mM NADH, and 67 mM formaldehyde. The reaction was initiated by the addition of purified BFD or mutants (0.05 mg/mL) at 37℃, and then an initial linear decrease in absorbance at 340 nm was observed. One unit of enzyme activity was defined as the amount of enzyme catalyzing the conversion of 1 μmol NADH per minute. Enzyme kinetics with formaldehyde as substrate were determined in assays with formaldehyde concentrations of 0.1-1000 mM. Kinetic parameters kcat and Km were estimated by measuring the initial velocities of enzymic reaction and curve-fitting according to the Michaelis-Menten equation, using GraphPad Prism 5 software. All experiments were conducted in triplicate.

Figure 4. NADH concentration standard curve

2. Part modification: obtaining mutant BFD-F464W with better catalytic performance
2.1 Design of the modification
The relationship between amino acids and substrates within the range of 5 angstroms of BFD active center was analyzed to infer the possible modification scheme of point mutations. By evaluating the relationship between amino acid No. 464 (phenylalanine, F) and the substrates, we speculate that phenylalanine can be replaced by tryptophan (W) to optimize the adaptability to the substrates of the enzyme active center, thereby increasing the enzyme performance.

Figure 5. Selection of single-site saturation mutation sites. The residues locating within 8Å distance from benzene ring of intermediate analogue were colored brown, thiamine diphosphate by green respectively

2.2 Enzyme-modified molecular cloning operation: PCR-based enzyme gene sequence mutation
a) Design the primers located at the mutation sites according to the mutated DNA sequence.
Forward primer sequence: GTACCTACGGTGCTCTGCGTTGGTGGGCTGGTGTTCTGGAA
Reverse primer sequence: CCACCAACGCAGAGCACCGTAGGTACCGTTGTTCATGATAA

Figure 6.Primer design of F464W

b) Conduct PCR reaction

Figure 8.Point mutant method and PCR program

c) Purify the PCR product with a DNA purification kit.
d) Add the appropriate amount of DMT enzyme, hold for one hour at 37 ° C.
e) Transform 5μl digested DNA into competent cells DH5α, incubate on ice for 30min.
42° C heat shock, 45s. Incubate on ice for 2min. add 200μl of LB. incubate at 37 °C for 1 h, 220rpm/min.
f) Pipet 200μl from each tube onto the plate with appropriate resistance, and spread the mixture evenly across the plate. Incubate at 37℃ overnight. Position the plates with the agar side at the top, and the lid at the bottom.
g) Select single colonies for sequencing.

2.3 Obtaining F464W enzyme
The coding genes of mutant F464W were ligated into the expression vector pET-28a via NdeІ and XhoI restriction sites. E. coli BL21(DE3) cells carrying different recombinant plasmids were inoculated into 5 mL LB (Luria Broth) medium with Kanamycine (100 μg/mL) and cultured overnight at 37°C, and then scaled up to 800 mL 2YT medium (16 g/L Tryptone, 10 g/L yeast extract, 5 g/L NaCl) containing Kanamycine (100 μg/mL). Gene expression was induced by adding IPTG (isopropyl-β-D-thiogalactopyranoside) to a final concentration of 0.5 mM when OD600 reached 0.6. The cell cultures continued to grow overnight at 16°C before being harvested by centrifugation at 6,000 g and then was resuspended in 50 mL lysis buffer (50 mM potassium phosphate buffer, pH 7.4, 5 mM MgSO4, 0.5 mM thiamine diphosphate ). The bacterial pellet was lysed by using a high-pressure homogenizer (JNBIO, China), and the cell debris was removed by centrifugation at 10,000 g for 60 min at 4°C. The soluble protein sample was loaded onto a nickel affinity column (GE Healthcare), rinsing with 50 mL wash buffer (50 mM potassium phosphate buffer, pH 7.4, 5 mM MgSO4, 0.5 mM thiamine diphosphate and 50 mM imidazole) and then eluting with 20 mL elution buffer (50 mM potassium phosphate buffer, pH 7.4, 5 mM MgSO4, 0.5 mM thiamine diphosphate and 200 mM imidazole). The eluted protein was concentrated and dialyzed against lysis buffer (50 mM potassium phosphate buffer, pH 7.4, 5 mM MgSO4, 0.5 mM thiamine diphosphate ) by ultrafiltration with an Amicon Ultra centrifugal filter device (Millipore, USA) with a 30 kDa molecular-weight cutoff. The protein concentration was determined using a BCA Protein Assay Reagent Kit (Pierce, USA) with BSA as the standard.

Figure 8.Expression of 3FZN（BFD F464W）. M, protein marker; 1, precipitation samples in the cell lysates; 2, supernatant samples in the cell lysates; 3, 50 mM imidazole eluent; 4, 100 mM imidazole eluent; 5, 200 mM imidazole eluent; 6, 300 mM imidazole eluent.

2.4 Simultaneous measurement and comparison of the Km and Kcat values of both BFD-F464W and wild-type BFD.
Refer to the above part characterization method for measurement.

Figure 9.BFD reaction rate

Figure 10.BFD-F464W reaction rate

	BFD(Wild type)	BFD-F464W
protein add amount[umol]	0.003690037	0.000184502
Vmax [umol/s]	0.00004699	7.99E-05
Km[M]	0.092	0.059
Kcat=Vmax/E(S-1)	0.01273429	0.4331122
Kcat/Km [M-1/S-1]	0.138416196	7.340884746

Table 1.Comparison of Enzyme Kinetic Parameters between BFD and BFD-F464W

Conclusion

Our new Biobrick part BFD-F464W has a functional improvement upon the existing Biobrick part BBa_K2155001. F464W's Km/Kcat is more than wild type.

Reference

[1] http://www.brenda-enzymes.org/
[2] https://www.uniprot.org/