Part:BBa_K2082251

Sequence for rpoZ Knock-Out in E. coli through CRISPR/Cas9

RpoZ knock-out/ reporter knock-in by CRISPR/Cas- BBa_K2082251

For the bacterial two-hybrid system using RpoZ as activation domain a knock-out of the native RpoZ protein synthesis is a usable step for increase the activation rate of the promoter. Under normal conditions the RpoZ protein would be guided by the beta´-subunit to the core complex of the polymerase as the last unit. If E. coli produces a lot of native RpoZ it competes with the RpoZ coupled with the HA4 Monobody. Therefore, it is possible, that most of the most polymerases build their core with the native RpoZ instead the RpoZ-HA4 fusion protein. In this complex it is not able to be recruited by the second fusion protein and the transcription activation of the reporter stay off.
An interesting fact is, that the RNA polymerase do not necessarily needs the RpoZ protein for their functionality (Gosh et al., 2001; Mathew et al., 2005). Therefore, the next step for the bacterial two-hybrid system is a knock-out of the native rpoZ gene combined with a knock-in of the beta-lactamase containing reporter(BBa_K2082238) in the genome of the specific E. coli strain. Moreover, the integration of the reporter construct in the genome reduces the background activity of the reporter down to one copy of the reporter per cell, instead of a big number of reporters correlating to the plasmid copy number containing the reporter construct.
With this part we designed a possibility to make this knock-out/knock-in experiment in nearly every E. coli genome. The more detailed view, how the CRISPR/Cas knock-out/knock-in work and a detailed application protocol is described below.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal AgeI site found at 596
  
• 1000
  INCOMPATIBLE WITH RFC[1000]

  Illegal BsaI site found at 1808
  Illegal SapI.rc site found at 2565
  

Attempt in detail

Figure 1: Illustration of the CRISPR/Cas-method for a knock-out/knock-in experiment. At first the Guide-RNA is bound at the Cas-Protein. Then the guide-RNA guides the Cas-protein to the specific point at the DNA, in our case the rpoZ gene, and make a cut (A). A designed DNA fragment containing the knock-in sequence flanked by two regions directly upstream and downstream of the knock-out gene is moving to the broken DNA sequence(B). Through homologous recombination the new DNA fragment interacts with the flanked regions of the knock-out gene (C) and replaced it completely (D).

The realization of such an experiment was made with the two plasmid CRISPR/Cas-system. The first plasmid pCas encodes the Cas protein and the second plasmid pTarget the small guide RNA sequence. If the guide RNA is expressed, it can guide the Cas protein to one specific sequence on the DNA. Now the Cas protein is able to cut the DNA at this specific sequence. Under normal conditions the cell would recognize the broken genome and would begin with a degeneration process of the whole cell. However, adding the right linear DNA sequence in addition to both plasmids within the bacterium, a special repair mechanism can cut out the broken sequence in the genome and add instead the added DNA sequence at the same place. In this experiment a DNA sequence containing the reporter was created, which is able to repair the genome after the Cas protein did a cut inside the rpoZ gene. Therefore the bacterium needs to cut out the rpoZ gene completely and has to integrate the designed DNA sequence to be alive.

Characterization

Based on the beta-lactamase gene, which was implemented by the knock-in of the reporter, the cultures were plated on LB agar with low concentration of ampicillin on it. Some of the growing cultures were picked for a colony PCR validation (figure 2).
Some bands on the gel are 2,300 to 2,400 bp in size. This is the expected length of the genomic sequence of the flanked rpoZ gene. Therefore, these results are negative. However, five bands on the gel are longer with about 3000 bp. With a length of about 1000 bp of the reporter and each time 1000 base-pairs of the two flanked fragments of the designed DNA construct, the expected length for a successful integration of the reporter gene in the genome was given. Therefore, the knock-out, knock-in experiment was successful and the reporter was perfectly integrated into the JS200 genome.

Figure 2: Results of the genomic cPCR of the possible knock-out/knock-in strains. For this gel 13 colonies of the ampicillin containing agar plates were picked. The expected band of the knock-out/knock-in strain was about 3000 bp in size. With the 1 kb ladder as the length standard, it is seen that the colonies 2, 6, 7, 9 and 13 have the expected result.

Application protocol

High efficiency Multiplex Genome Editing (Cobb et al. 2014)

Assembly of the guide RNA in pTarget:

• Design of the guide RNA: 20 nt of interest with 3' protospacer adjacent sequence (PAM) NGG, where N is any nucleotide. Preference is given to:
  • sequences with purines occupying the last four (3') bases of the protospacer.
  • sequences on the non-coding strand.
  • sequences in which the last 12 nt protospacer + 3 nt PAM (15 nt total) are unique in the genome (check by BLAST with all four possible NGG sequences)
• For knock-out of the rpoZ gene of E. coli the following sequence can be used:
  • 5'- CGACCAGTACCAGGTCAAAACGG -3'
• Design two 24 nt oligonucleotide (4 nt 5' sticky end + 20 nt spacer sequence) with the sticky ends ACGC on the forward primer and AAAC on the reverse primer. For the rpoZ knock-out the two primers are:
  • Guide-fw: 5'-ACGCCGACCAGTACCAGGTCAAAA-3'
  • Guide-rv: 5'-AAACTTTTGACCTGGTACTGGTCG-3'
  The sticky ends are designed for the BbsI sites.
• For single spacer, anneal single spacer oligos as follows:
  • Resuspend both oligos to 100µM in water
  • Mix 5µl Guide-for + 5µl Guide-rev + 90 µl 30mM HEPES, pH 7.8
  • Heat to 95°C for 5min, then ramp to 4°C at 0.1°C/sec
• Insert annealed spacer by Golden Gate assembly,
  Golden Gate reaction mixture:

  • Backbone	X µl	100 ng
    Insert	0.3 µl	From 10-fold diluted annealed oligo stock
    T4 Ligase Buffer (NEB)	2 µl
    T4 Ligase (NEB)	1 µl	400 U/µl stock is sufficient; add last
    BbsI	1 µl	Stored at -80°C
    H2O	Y µl
    In sum	20 µl

  Golden Gate Program:
  • 37°C , 10 min
  • 16°C , 10 min
  • Goto step 1, 9 times
  • 50°C , 5 min
  • 65°C , 20 min
  • 4°C , forever
• Transform 3 µl of each reaction to E. coli DH4α by heat shock(manufacturer's protocol) or electroporation(manufacturer's protocol)
• Plate 10% of recovery culture on selective plates with 10 µl of 0.5M IPTG and 40 µl of 20 mg/ml Bluo-gal (in DMSO).
• Pick white colonies to selective LB (for pTarget use streptomycine) and recover plasmid.

CRISPR/Cas knock-out/knock-in:

• Transformation of pCas9 in willed knock-out strain via electroporation:
  • Preheat SOC medium with 0.1% arabinose by 30°C
  • Thaw 50 µL electrocompetent E. coli cells (the knock-out/knock-in strain)on ice, dilute with icecold 50 µL glycerine (10%) if necessary
  • Add 1-5 µL plasmid to 50 µL electrocompetent cells
  • Store cells on ice for 1 minute
  • Electroporate at U = 2.5 kV, C = 25 µF, R = 400 Ω
  • Transfer transformation reaction to 950 µL prepared SOC-Medium and incubate 1 h at 30 °C
  • Plate on LB-Medium prepared with kanamycine and 0.1% arabinose
  • Incubate over night at 30 °C
• Create electrocompetent cells of the knock-out/knock-in strain carrying the pCas plasmid. ATTENTION: cultivation of the cells by 30°C in LB with 0,1% arabinose!
• PCR with the BioBrick BBa_K2082251:
  • Q5 master mix (25 µL):
    • 5 µL 5 x Q5 buffer
    • 0.5 µL 10 mM dNTPs
    • Up to 50 ng/µL-template (BBa_K2082251)
    • 0.1 µL Q5 DNA polymerase
    • 0.5 µl forward-primer:CC_FragAB_Reporter_fw
    • 0.5 µl reverse-primer:CC_FragAB_Reporter_rv
    • Ad 25 µL dH2O
  • Q5 standard protocol:
    • Initial denaturation: 98°C - 30 s
    • 30-35 cycles of:
      • Denaturation: 98 °C - 20 s
      • Annealing: 58 °C - 30 s
      • Elongation: 72 °C - 20 s/kb
    • Final elongation: 72 °C - 5 min
    • Storage: 4 °C
• Purification of the PCR product (manufacturer's protocol)
• Transformation of the purified PCR product and the guide-RNA-carrying plasmid pTarget in the pCas-carrying competent knock-out/knock-in strain of E. coli via electroporation
• Preheat SOC medium with 0.1% arabinose by 30°C
• Thaw 50 µL electrocompetent pCas-carrying E. coli cells (the knock-out/knock-in strain)on ice, dilute with icecold 50 µL glycerine (10%) if necessary
• Add 1-3 µL pTarget plasmid to 50 µL electrocompetent cells
• Add 2 µL purified PCR product to 50 µL electrocompetent cells
• Store cells on ice for 1 minute
• Electroporate at U = 2.5 kV, C = 25 µF, R = 400 Ω
• Transfer transformation reaction to 950 µL prepared SOC-Medium and incubate 1 h at 30 °C
• Plate first half of the transformed cells on LB-Medium prepared with kanamycine, streptomycine and 0.1% arabinose
• Plate second half of the transformed cells on LB-Medium prepared with kanamycine, streptomycine and 0.1% arabinosen + 20µg/ml ampicillin
• Incubate over night at 30 °C
• Pick colonies from the ampicillin-prepared LB plate and accomplish a colony PCR:
• 5 µL 5x GoTaq buffer (Promega)
• 1 µL MgCl₂ (25 mM stock)
• 0.5 µL dNTPs (10 mM each)
• 0.25 µL primer mix (prefix/suffix primers or sequencing primers) 100 mM
• 17.625 µL ddH₂O
• 0.125 µL GoTaq polymerase (Promega)
• 0.5 µL template
• PCR program
• Cell lysis and denaturation: 5 min, 95 °C
• 30 cycles
• Denaturation: 10 s, 95 °C
• Hybridisation: 30 s, annealing temperature
• Elongation: 60 s/kb of product, 72 °C
• Final elongation: 5 min, 72 °C
• Template alternatives
• Pick a colony with sterile tip, elute in 100 µL ddH₂O or buffer, store at 4 °C during PCR, plate if insert is of correct size
• Pick colony, streak at marked position on a new plate and solute remaining cells on the tip in the PCR tube with reaction mixture, cultivate if insert is of correct size
• Gel electrophoresis for control of fragment size
• Colonies with a fragment size of about 3,000 bp are the cells, with knock-out of the E. coli rpoZ gene and knock-in of the reporter BBa_K2082238

References

• Cobb, Ryan E.; Wang, Yajie; Zhao, Huimin (2015): High-efficiency multiplex genome editing of Streptomyces species using an engineered CRISPR/Cas system. In: ACS synthetic biology 4 (6), S. 723–728. DOI: 10.1021/sb500351f.
• Ghosh, P.; Ishihama, A.; Chatterji, D. (2001): Escherichia coli RNA polymerase subunit omega and its N-terminal domain bind full-length beta' to facilitate incorporation into the alpha2beta subassembly. In: European journal of biochemistry 268 (17), S. 4621–4627.
• Mathew, R., Ramakanth, M. & Chatterji, D. (2005). Deletion of the gene rpoZ , encoding the omega subunit of RNA polymerase, in Mycobacterium smegmatis results in fragmentation of the b ’ subunit in the enzyme assembly. J Bacteriol 187 , 6565–6570.