Part:BBa_K1796203

An unloaded sgRNA that contains BbsI cutting site, with a promoter and terminator.

This part contains a sgRNA which we designed to be expressed in procaryotic organism. There is a promoter in fron of it and a terminator behind.Instead of a certain crRNA, we designed a BbsI cutting site in the middle of the sgRNA, on the place where the crRNA should be. So we can use this part to knockout any sequence as we want in procaryotic organism by the way of CRISPR. The constitutive promoter and the terminator are based on biobricks BBa_J23100 and BBa_B0012, respectively. To make these two parts more compatible with our sgRNA, we made some modifications on them. For the promoter, we changed -10 box into TATAAT, aiming at higher efficiency of transcription. What’s more, only the core domain of terminator B0012 which can form hairpin structure and oligo U were chosen. We have to make the part a short one to avoid undesired situations, for example, the sgRNA is too long to combine with Cas9 protein.

According to the iGEM team of Freiburg University 2013 project, the sequence of crRNA and tracrRNA are shown as below:

crRNA: gttttagagctatgctgttttgaatggtcccaaaacgggt (repeat1) cttcgagaagac (cutting site) gttttagagctatgctgttttgaatggtcccaaaactttttctagcgc ( repeat2)

tracrRNA :ttggaaccattcaaaacagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (core domain) ttttttttggc

To construct a universal part, we referred to the 2013 project of Freiburg iGEM team and added a BbsI restriction site to the sequence of crRNA by which any required target sequence can be inserted. sgRNA is the recombination of crRNA and tracrRNA. In reference of other articles, the sequence of sgRNA is shown as below:

sgRNA: ca<aaacgggtcttcgagaagacgt>tttagagcta (part of repeat2) gaaa (a linker between crRNA and tracrRNA) tagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggca ccgagtcggtgc (main trunk of tracrRNA) tttttt (oligo U assist to terminate transcrption)

To standardize this sgRNA, we added prefix and suffix as well as modified promoter BBa_j23100 and terminator BBa_B0012.

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal prefix found in sequence at 1
  Illegal suffix found in sequence at 185
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal EcoRI site found at 1
  Illegal NheI site found at 29
  Illegal NheI site found at 52
  Illegal SpeI site found at 186
  Illegal PstI site found at 200
  Illegal NotI site found at 7
  Illegal NotI site found at 193
  
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal EcoRI site found at 1
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal prefix found in sequence at 1
  Illegal suffix found in sequence at 186
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal prefix found in sequence at 1
  Illegal XbaI site found at 16
  Illegal SpeI site found at 186
  Illegal PstI site found at 200
  
• 1000
  COMPATIBLE WITH RFC[1000]