Part:BBa_K1723019
c7_2 gRNA expressing sequence
The c7_2 guide RNA (gRNA) consists of the 20 base pair specificity determinant sequence (SDS) c7_2 (TTGTTTACAGATCAATCCAT) followed by a gRNA scaffold that stabilizes the RNA complex. The gRNA is flanked by two self-cleaving ribozymes: a Hammerhead Ribozyme and a Hepatitis Delta Virus (HDV) Ribozyme thus freeing the gRNA from the rest of the RNA transcript, and making it possible to produce the gRNA using RNA Polymerase II [1]. Then, the gRNA can form a complex with dCas9-VP64 (BBa_K1723021) (or theoretically other Cas9 mutants). The complex c7_2-dCas9_VP64 will bind specifically to TTGTTTACAGATCAATCCAT sequences in the genome of the host organism situated directly before a PAM sequence (NGG). Binding of the complex on the c7_2 sequence of promoter CYC_2 (BBa_K1723024) will result in inhibiting CYC_2 via steric hindering of the RNA polymerase II binding site by dCas9_VP64. A similar mechanism has been proven to work with gRNA c7_0 (produced by BBa_K1723017) and promoter CYC_0 (BBa_K1723022) [2].
To learn more about how this part was used specific to our project, please follow this link: http://2015.igem.org/Team:EPF_Lausanne/Part_Collection
Usage and Biology
S. cerevisiae
None |