Part:BBa_K1723014
c6_1 gRNA expressing sequence
The c6_1 guide RNA (gRNA) consists of the 20 base pair specificity determinant sequence (SDS) c6_1 (ATTAGAATATTCAATGTATA) followed by a gRNA scaffold that stabilizes the RNA complex. The gRNA is flanked by two self-cleaving ribozymes: a Hammerhead Ribozyme and a Hepatitis Delta Virus (HDV) Ribozyme thus freeing the gRNA from the rest of the RNA transcript, and making it possible to produce the gRNA using RNA Polymerase II [1]. Then, the gRNA can form a complex with dCas9-VP64 (BBa_K1723021) (or theoretically other Cas9 mutants). The complex c6_1-dCas9_VP64 will bind specifically to ATTAGAATATTCAATGTATA sequences in the genome of the host organism situated directly before a PAM sequence (NGG). Binding of the complex on the c6_1 sequence of promoter CYC_1 (BBa_K1723023) will result in inhibiting CYC_1 via steric hindering of the RNA polymerase II binding site by dCas9_VP64. A similar mechanism has been proven to work with gRNA c6_0 (produced by BBa_K1723013) and promoter CYC_0 (BBa_K1723022) [2].
To learn more about how this part was used specific to our project, please follow this link: http://2015.igem.org/Team:EPF_Lausanne/Part_Collection
Usage and Biology
S. cerevisiae
None |