RNA

Part:BBa_K1723009

Designed by: Cyril Pulver   Group: iGEM15_EPF_Lausanne   (2015-09-16)

c3_0 gRNA expressing sequence

The c3_0 guide RNA (gRNA) consists of the 20 base pair specificity determinant sequence (SDS) c3_0 (GTACATACAGTAGGATCCTA ) followed by a gRNA scaffold that stabilizes the RNA complex. The gRNA is flanked by two self-cleaving ribozymes: a Hammerhead Ribozyme and a Hepatitis Delta Virus (HDV) Ribozyme thus freeing the gRNA from the rest of the RNA transcript, and making it possible to produce the gRNA using RNA Polymerase II [1]. Then, the gRNA can form a complex with dCas9-VP64 (BBa_K1723021) (or theoretically other Cas9 mutants). The complex c3_0-dCas9_VP64 will bind specifically to GTACATACAGTAGGATCCTA sequences in the genome of the host organism situated directly before a PAM sequence (NGG). Binding of the complex on the c3_0 sequence of promoter CYC_0 (BBa_K1723022) will result in activating CYC_0 via recruitment of the RNA polymerase II by the VP64 subunit of dCas9_VP64[2].

To learn more about how this part was used specific to our project, please follow this link: http://2015.igem.org/Team:EPF_Lausanne/Part_Collection


Usage and Biology

Was used in S. cerevisiae.

[edit]
Categories
Parameters
None