Part:BBa_K1679005
GFP Reporter
This is a device that contain promoter BBa_J23117, RiboJ and BBa_I13504.
Overview
Promoter parts are often defined by a relatively short (~50 bp) sequence, but regions 100 bp or more upstream can affect promoter strength, and the effect of remote sequences can be reduced by including an insulator region.Ribo J is a kind of ribozyme-based insulator part that can buffer synthetic circuits from genetic context. It is a useful tool for measuring the strength of promoters which can make the disruption from genetic context to be reduced.
As a matter of fact, our results from plate reader and flow cytometer show that the expression of GFP under J23117 promoter have a little difference with or without Ribo J. It proved that the Ribo J did has the function of buffering.
Attention Please!
The right sequence should be "ttgacagctagctcagtcctagggattgtgctagctactagagagctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaatactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata". But the DNA Sample we submit is correct. We are so sorry for this problem.
Plate Reader Result
Equipment
Varioskan Flash Multimode Reader
Thermo Scientific
Read Speed: 6.4 well per second
Software
Run Software Version: Skanlt Software 2.4.5 RE for Varioskan Flash
Current Software Version: Skanlt Software 2.4.5 RE for Varioskan Flash
Protocol
Date: 2015 Aug 12
1. Set our instrument to read OD600
2. Setup a 96-well plate with our cultures
3. Take the measurement and record it
4. Calculate the dilution required for each sample (OD600=0.5)
5. Dilute each sample
6. Remeasure our sample on OD600
7. Recalculate our dilution and remeasure until it's within 5% of 0.5.
Unit
Three technical replicates of M9 liquid media was measured, which were called background value.
A series of concentration of sodium fluorescein was measured, which are 0, 10, 20, 40, 80, 160, 320, 640 ng/mL . A calibration curve was defined.
Dataset
All samples were cut the mean of background value, and then compared with the calibration curve to get the final dataset in units of fluorescein.
TR: Technical Replicate
BR: Biological Replicate
Flow Cytometer Result
Equipment
Epics-XL
Beckman Coulter
Protocol
Date: 2015 Aug 12
1. Start up the instrument and warm up it until it shows “Awaiting Sample”
2. Calibrate the instrument with check beads
3. Mix the fluorescent beads and negative sample (E coli. without plasmid) and dilute it to 1 mL
4. Measure the mix and regulate voltage until the points appear in the appropriate location and set gates
5. Measure the other samples in three biological replicates and three technical replicates
6. Use the Cleanase and ddH2O to clean the instrument as instruction
7. Process the data
Unit
The fluorescence of GFPwas compared with the 2.00μm Fluoresbrite Yellow Green (YG) Microspheres.
Dataset
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 788
//function/reporter
//function/reporter/fluorescence
chassis | E. coli K-12 DH5-alpha |
device_type | |
emission | 511nm |
excitation | 501nm |
function |