Part:BBa_K1620000
Promoter element UspA
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Contents
Usage and Biology
The universal stress protein A is a response of Escherichia coli cells to growth arrest, and its lacking generates cells with defective growth. For more information about this important protein, please feel free to visit the respective Wikigenes page (https://www.wikigenes.org/e/gene/e/948007.html). The universal stress protein A promoter (also as known as PuspA) is a well characterized promoter element, inducible under several stress conditions (Prytz et al. 2003; Dyk et al. 1995; Nyström and Neidhardt 1992; 1994). This genetic element is dependent to sigma-70 factor (Nyström and Neidhardt 1992; 1994). Its regulation is done through the concentration of a specific stationary phase allormone, guanosine-5'-diphosphate-3'-diphosphate (ppGp), as described elsewhere (Farewell et al. 1998). The ppGp activate the transcription of downstream elements through a positive regulation of the β-subunit of RNA polymerase. In this sense, the PuspA element is considered a stationary phase promoter. However, in the work of Prytz et al. (2003) a constitutive transcription promotion was observed.
Diverse conditions make the Escherichia coli cell enter to stress state, like heat shocks, starvation, osmotic stress, ultraviolet light and other conditions. In these situations, the RNA polimerase sigma factors (ropS) trigger the expression of chaperones and other stress protector molecules, in order to help the cell survive. Previous works have showed the power of the element PuspA, like shown in the Table 1.
Promoter Design
The force of this genetic element is important for construction of several devices, since environmental monitoring of toxic compounds to devices of triggered expression like this specific situation. We have drawn the sequence for an improved PuspA promoter from an analysis of 400bp upstream the Universal Protein A (UspA) gene in E. coli K12. First we have used the Scope tool (http://genie.dartmouth.edu/scope/), and we found the domain WWRBAM:
This analysis indicated to us the sequence 5'-AAGCAT-3' as vital and potential component of promoter region. Restarting the analysis with Neural Network Promoter Predictor (http://www.fruitfly.org/seq_tools/promoter.html), the following sequence was obtained:
5' – TGAGTTTTCAATCACCTTTCCATCCACCTTATATTAAGCATGGAGG - 3'
This sequence has a transcription starting at bolded T and italicized the sigma factor binding sites. The confidence of the promotion activity of this sequence was estimated as 100%. Using this part attached to the iGEM prefix and suffix through polymerase chain reaction (PCR), the construction of pSB1C3 derived vector was carried out with current assembly methods, as shown below (the orientation is 5' > 3'):
Interestingly, the lineages carrying these plasmids have a slow growth behavior, in comparison to cells carrying the pSB1C3 plasmid. In order to report its activity, we have fusioned the biobrick part BBa_E0840 (RBS/B0030+GFP/E0040+Terminator/B0015) downstream to our promoter making other new biobrick BBa_K1620005. This construct was used to evaluate the puspA element activity. Since the start, we observed a green color in colonies of E. coli DH5α after their growth at 37°C and posterior incubation for 16h at 4°C in lysogenic agar supplemented with chloramphenicol 10 μg/mL (LB agar plus Chloram.). These colonies were selected and passed through a confirmatory polymerase chain reaction. The best producing clone was selected and used for further experimentation and plasmid production.
GFP expression tests
Cold shock performance
The E. coli DH5α clone carrying the construct puspA::gfp was grown in 100 mL of lysogenic broth containing chloramphenicol as previously referred (LB plus chloram) in a 500 mL Erlenmeyer flask under 200 rpm at 37°C. After culture reach optical density of 0.5, a sample of 5 mL was collected for protein analysis. The remaining broth was transferred to a 4°C chamber without agitation for 16 h. The cells were harvested by centrifugation. The protein analysis was carried out through a SDS-PAGE, using normalized samples, and a GFP fluorescence reading in black Elisa plates using Viktor (Perkin-Elmer).
The SDS-PAGE revealed a similar effect of GFP production using the both tested promoters puspA and a control constitutive promoter pJ23101 (BBa_J23101). In this sense, the constitutive promotion of puspA was reinforced. But, when the fluorescence method was assessed, the fluorescence of samples obtained from puspA promotion was clearly brighter than the control promoter system. Furthermore, the protein quantities despite equivalent are not of the same qualities since the GFP bright is proportional to its folding. In this sense, we can conclude that puspA is not only constitutive in certain conditions; it is more suitable for complex folding proteins.
Osmotic shock induced by PEG 6000
As previously reported, we choose to test the promoter element puspA::gfp under different osmotic pressures. The compound poly(ethylene glycol) 6000 Da, also known as PEG 6000, is a hydrophilic compound which could adsorbs high amounts of water molecules, without change the ionic charge in medium, in this sense, only the reduction of the osmotic pressure would be tested.
The strain E. coli DH5α_puspA::gfp was grown under soft conditions (Lysogenic Broth Chloramphenicol supplemented, 37°C – 200 rpm) overnight, and cells were harvested from 2 mL cultures by centrifugation (4,000 rpm – 4°C, 6 min). These cells were resuspended in 1 mL of Lysogenic broth containing the right antibiotic and different concentrations of PEG 6000 ranging from 0 to 30% (in 2% steps until 20%). The 96 deep well plates were incubated at 37°C for 4 h, under 200 rpm. Finally, the cells were harvested by centrifugation as described before and the lysis was carried out after resuspension of cells in 180 μL of lysis buffer (10 mM Tris-HCl, 100 mM NaCl, 50 mM NaH2PO4, pH 7.5) with 20 μL volume of neutral detergent based lysis solution 10X (10mM EDTA, 10 mg/mL Lysozyme, 10% Triton X-100, 100 mM Tris-HCl – pH 8) at room temperature for 15 min with careful agitation at each 5 min. After lysis, the cell debris was precipitated by long time centrifugation (4,000 rpm – 4°C, 45 min) and the supernatant was collected to a 96 well Elisa black plate. The GFP was measured in Viktor (Perkin Elmer) plate fluorometer.
A 6xHis-Tagged version of our GFP was previously cloned into pET28a vector. The expression was carried out using a cell culture of Escherichia coli Rosetta(DE3) at optical density of 0.5 in lysogenic broth supplement with chloramphenicol (20 μg/mL), kanamycin (25 μg/mL) and 0.4mM IPTG. The induction time and temperature were 4h at 37°C, respectively, in a shaker (200 rpm). Cells were harvested by centrifugation and lysed by ultra-sonication. The lysate was further centrifuged and 0.22 μm filtered. The GFP present in supernatant was purified using an imidazole gradient in a Ni2+-NTA (Qiagen) column. The expression and purification profiles follow attached. A standard curve of purified GFP and fluorescence was previously established allowing the comparison of molecule number and promoter elements.
High amounts of GFP have shown a quantic quenching phenomenon, where the equipment is not able to detect proportional changes when high protein quantities are changed. In figure 6A, the plateau is evident and starts at 48 nM, to avoid this, we have adopted a standard curve (Figure 6B) using the linear region of the graphic (between 0 nM and 20 nM), transforming the GFP concentration (nM) to molecules. The collected data follow bellow:
First of all, the puspA promoter has a higher activity than pJ23101 in all tested PEG concentrations. The data revealed a trend to reduction of GFP production along the PEG 6000 concentration increases from 0% to 30% (wt. / vol.). Higher concentrations of PEG 6000 turns the water molecules less available to cell, in this sense, we observe a phenomenon called plasmolysis. During plasmolysis the bacterial metabolism is suspended or reduced to very low rates, allied to a cell volume reduction implying in a retraction of the cytoplasmic volume. Despite the occurrence of all these events, no one of them is observable, even under microscope. This process could be useful for bacterial distribution and preservation technologies.
The preliminary results still indicated a need for osmotic pressure changes triggered by ionic compounds to start or reinforces puspA activity. Previous studies used NaCl as an osmotic agent. We believe that these ions trigger a complete stimulus, involving efflux pumps. Our results allied to literature indicated to us, the need of an ionic unbalance allied to higher osmotic pressures and lower water activities to trigger puspA.
In this sense, this stress caused by non-ionic compounds, like PEG 6000, seems to be not so effective to production of interesting proteins coupled to this promoter element. Other informations seem to corroborate with our statements, since the carbon sources should be depleted to a full puspA activity, as previously described (Dyk et al. 1995, Gawand and Griffiths 2005). In a strict sense, the carbon sources in this test medium just are not depleted, and are reinforced by PEG 6000, a glycol polymer and potential useful energetic source for E. coli (EcoCyc, Pathway: ethylene glycol degradation) as seen at Figure 9.
In summary, the plasmolysis technique was extremely useful to stop the metabolic activity of bacterial cell. A reversal of this framework could trigger the production of proteins coupled to the element puspA. This is the base of our final repellent product, but in order to element characterization, we still observe that increasing concentrations of this osmolyte are not effective to rise up the puspA activity due to its nutritional base for cells.
Carbon Starving
As previously referred the promoter puspA is sensitive to growth arrest and starvation. In order to study its behavior the cells carrying puspA::gfp (BBa_K1620005) and pJ23101::gfp (BBa_K1620006) were grown overnight in Lysogenic broth supplemented with chloramphenicol at 37°C under 200 rpm. Then, the cells were harvested by centrifugation and washed with sterile Tris-Saline (10mM Tris-HCl pH 8.0, 150 mM NaCl). Cells were resuspended in two different media: Lysogenic broth and Poor Medium (2 g/L Ammonium Sulfate, 13.6 g/L Monobasic Potassium Phosphate, 25 mg Lysogenic Broth (HiMedia), 10 μg/mL Cloramphenicol, filter sterilized), at equal optical densities. The cultures were incubated at 37°C under 200 rpm for 4h. Samples were collected at each hour and in the initial times. Finally, the cells were lysed as to the test of osmotic shock. A SDS-PAGE was used to compare the crude protein extracts, and the fluorometer was used to quantify the total produced GFP (as previously referred).
A complete profile of expression was obtained (Figure 10). The pJ23101 promotion occurs at high levels in the first three hours, like element puspA, in rich medium. Indeed, seems that the crude amounts of GFP are higher in the puspA, reinforcing the results obtained before. However, the quantities of insoluble GFP are also higher in puspA than pJ23101. The results still reveals that genes promoted by puspA, during starvation, have a kind of protection of proteolysis, when compared with the pJ23101 in poor medium.
These results (Figure 10 and 11) are in accordance to previously reported by Gawand and Griffiths (2005), where the cells response to starvation using element puspA was higher at 3h from the starting of the experiment and is more accentuated than other stress promoters, and also to the constitutive promoters. In this sense, the use of this promoter in poor nutritive solutions is recommended, and the maximum answer occurs at 3h.
Conclusions
As shown above, the promoter pUSPA is constitutivelly more efficient than promoter reference (BBa_J23101), however it did not presented an inducible character as previously reported. Another evaluations are need to infer this feature. Furthermore, it could be usefull to genic expressing under hard conditions to cell, as proved by osmotic shock and cold shock. These results show pUSPA as an interesting element to be incorporated in several iGEM future projects, and new exciting biotechnological applications.
References
Dyk T.K.V., Smulski D.R., Reed T.R., Belkin S., Vollmer A.C. and LaRossa R. 1995. Responses to Toxicants of an Escherichia coli Strain Carrying a uspA9::lux Genetic Fusion and an E. coli Strain Carrying a grpE9::lux Fusion Are Similar. Applied and Environmental Microbiology 61 (11): 4124–4127. DOI: 0099-2240/95/$04.0010.
Farewell A., Kvint K. and Nyström T. 1998. uspB, a New sigmaS-Regulated Gene in Escherichia coli Which Is Required for Stationary-Phase Resistance to Ethanol. Journal of Bacteriology 180 (23): 6140–6147. DOI: 0021-9193/98/$04.0010.
Gawande P.V. and Griffiths M.W. 2005. Effects of environmental stresses on the activities of the uspA, grpE and rpoS promoters of Escherichia coli O157:H7. International Journal of Food Microbiology 99: 91–98.
Nyström T. and Neidhardt F.C. 1992. Cloning, mapping and nucleotide sequencing of a gene encoding a universal stress protein in Escherichia coli. Mol. Microbiol. 6: 3187–3198.
Nyström T. and Neidhardt F.C. 1994. Expression and role of the universal stress protein, UspA, of Escherichia coli during growth arrest. Mol. Microbiol. 11: 537–544.
Prytz I., Sandén A.M., Nyström T., Farewell A., Wahlström A., Förberg C., Pragai Z., Barer M., Harwood C. and Larsson G. 2003. Fed-Batch Production of Recombinant Beta-Galactosidase Using the Universal Stress Promoters uspA and uspB in High Cell Density Cultivations. Biotechnology and Bioengineering 83 (5): 595-603. DOI: 10.1002/bit.10716.
//promoter/stresskit
//regulation/multiple
| None |