Part:BBa_K1442100
RdRP
RNA Dependent RNA Polymerase (RdRp)
Background
RNA dependent RNA polymerase (RdRp) is an enzyme which catalyses the replication of RNA from an RNA template. An essential protein encoded within viruses that lack a DNA phase and replicate using negative sense RNA. The submitted RdRp part derives from the Hepatitis C virus con1 strain, RdRp is also referred to as non-structural protein 5B (NS5B). Part sequence was derived from Lohmann et al., 1997, with the authors achieving full expression and activity of RdRp in a baculovirus expression system. Membrane association of RdRp is essential for replication of HCV subgenomic regions, with the C-terminal tail containing 21 amino acids which confer high hydrophobicity and mediate insertion into the membrane (Moradpour et., 2004). The C-terminal tail preceding the C-terminal hydrophobic insertion sequence interacts with structural elements including the β-hairpin loop of NS5b (Leveque et al., 2003). The β-hairpin loop inserts into the active site, believed to position the 3’ terminius of HCV viral RNA to initiate RNA synthesis (Hong et al., 2001). RdRp initiates RNA synthesis with nucleotide transfer activity found within the palm motif (Figure 1a & b), with several amino acid residues implicated in nucleotide triphosphate contact (Bressanelli et al., 2002). RdRp requires 5’ and 3’ untranslated regions (UTRs) found within the HCV genome to direct RNA synthesis. The UTRs form ordered RNA structures and are evolutionary conserved.
Figure 1. Ribbon diagram of HCV RNA polymerase (NS5B). (left) Molecular surface rendering of NS5B. Images depict the palm, thumb and fingers domain of the RNA dependent RNA polymerase. Taken from (O’Farrell et al., 2003) http://www.ncbi.nlm.nih.gov/pubmed/12589751
Experimental Design
To characterize the RNA dependent RNA polymerase, constructs with 3’ untranslated regions (UTRs) in combination with a Reverse GFP were introduced in E. coli. The 3’ UTRs comprise previously used DNA sequences that promote RdRp activity. Further information on the 3’ UTRs is below (n.b. only some of the 3’ UTRs listed below have been stably transformed and been used to characterize mRdRp and RdRp activity.
B2(−)26G
5’ GGATTGAACCTCGTTCCGTGGTTTACG 3’C2(−)29G
5’ GGTTGAACCGTACGCCTTTGTAAATAAACG 3’SLC+8
5’ GGACGCATGGGCTTGCATAGCAAGTCTAGATATGCGTCCAGAGACCA 3’SLdel+8
5’ GGCTTGCATAGCAAGTCTAGATATGCGTCCAGAGACCA 3’SLD3
5’ GGGCTTGCATAGCAAGTCTGAGACC 3’Mutant RNA dependent RNA polymerase (mRdRp in Figure 4)
Part BBa_K1442102 was also characterized in tandem with the normal RNA dependent RNA polymerase (RdRp in Figure 3). Mutant RNA dependent RNA polymerase is edited, with the removal of a Bgal1 restriction site in the sequence, as this is not biobrick compatible it has not been uploaded to the registry. Normal RNA dependent RNA polymerase is not biobrick compatible but has undergone site directed mutagenesis to remove the PstI site in a silent substitution mutation.
Figure 3. Construct depiction. Plasmid containing RNA dependent RNA polymerase (RdRp), driven by a T3 promoter in combination with an ampicillin resistance gene for selection of transformant colonies. For clarity, biobrick prefix and suffix sequences not shown.
Figure 4. Construct depiction. Plasmid containing mutant RNA dependent RNA polymerase (RdRp), driven by a T3 promoter in combination with an ampicillin resistance gene for selection of transformant colonies. Mutant RdRp is not biobrick compatible, but has been included as an additional control.
Figure 5. 3’ UTR and Reverse GFP general construct depiction. Plasmid containing reverse GFP and 3’ UTR is depicted below. This was used to characterize RdRp and mRdRp activity in E. coli. 3’ UTRs were interchangeable and are referred to as S3, R5 and C2/HP. 3’ UTRs and Reverse GFP are biobrick compatible. For clarity, biobrick prefix and suffix sequences not shown.
Improve
At the C-terminus of the original NS5B, the 2019 Nanjing_NFLS team added a nuclear localization sequence with a repeat sequence to ensure that the protein can enter the nucleus efficiently so that it can be further designed in transcriptional regulation.
A: NS5B (no NLS)
B: DNLS-NS5B (after adding NLS)
We transfected NS5B and DNLS-NS5B with NLS (nuclear localization sequence) into HepG2 cells respectively and detected them by immunofluorescence. The results are shown in figures. NLS-free NS5B was mainly expressed in the cytoplasm, while the NS5B protein with NLS (nuclear localization sequence) was obviously colocalized with the nucleus, which proved that NS5B entered the nucleus successfully.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 492
Illegal BglII site found at 1340 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 537
| n/a | RdRP |